Busch Lab

ZMP

ENSDARG00000087569

Ensembl ID:
ENSDARG00000087569
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44248 Nonsense Mutation detected in F1 DNA Not yet available
sa9650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124557 Nonsense 219 375 5 7
Genomic Location (Zv9):
Chromosome 25 (position 12751591)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13102868
GRCz11 25 13199373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAGTCGTATATTTCTGGTGCCTGGGGCCGCGATGCTCTACTAACGGAT[A/T]AGGAGCGTTATTGGGAACACTGTCTAGTGAGTGGACACAAGGATGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124557 Nonsense 275 375 5 7
Genomic Location (Zv9):
Chromosome 25 (position 12751761)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13102698
GRCz11 25 13199203
KASP Assay ID:
2261-9453.1 (used for ordering genotyping assays)
KASP Sequence:
CCATCTTACAGCAGTRAAAATGCAGTTCGAGGTTCTGGCACTATACTCTA[C/A]AACAAYACCGTATATTATCAMTGCYACGACAAAGCTGAAATCTGTAGYTT
Associated Phenotype:
Not determined