Busch Lab

ZMP

si:ch73-105b23.1

Ensembl ID:
ENSDARG00000087558
ZFIN ID:
ZDB-GENE-081107-41
Description:
Novel EGF domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JM10]
Human Orthologue:
LTBP3
Human Description:
latent transforming growth factor beta binding protein 3 [Source:HGNC Symbol;Acc:6716]
Mouse Orthologue:
Ltbp3
Mouse Description:
latent transforming growth factor beta binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1101355]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa28065 Nonsense Mutation detected in F1 DNA Not yet available
sa18341 Nonsense Available for shipment Available now
sa1273 Nonsense Available for shipment Available now
sa22224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 270 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8194044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496564
GRCz11 13 8828587
KASP Assay ID:
2260-6053.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCATTCTTCTGTGACTGTGGTCAAGGGTATAACTTTACTCAAAAT[C/T]AGTGTGTAGATTTGGATGAATGTGCCATAGGACTTTGCAGTCCTTATGCT
Long Flanking Sequence:
ATGGAAATTATCTCTGCCTAGATGTCGATGAGTGTTCAGAGACACCTGGTGTGTGCTCTGCTTTATTGGGATATAAAGGTTGCAAGAACCTGCAAGGAACCTACACCTGCCTCTGTAACAGTGGCTATCAAAGCAATGGACAGACATGTGTGGACATCAATGAATGTCAAATCAACTTCTGCAGCCCATTTGCTGATTGTACTAACTTGCCAGGCTCATATCGATGCACCTGTCCTGAAGGATTTAATGGAAACGGCTTGGCATGTGTAGACATCAATGAGTGTGATAGAAAGAACAGCTGTGACCCCAATGCATTATGTACAAATCTGCTTGGAAGCTACAAATGTTCCTGCCGCTCTGGGTTCCTGGGTATTGGTACAAAGTGCACTGACATTAATGAATGTGCCACCGATAACATTTGCCCAGCCGTTGCTGCATGTGTCAACACAGCAGGTTCATTCTTCTGTGACTGTGGTCAAGGGTATAACTTTACTCAAAAT[C/T]AGTGTGTAGATTTGGATGAATGTGCCATAGGACTTTGCAGTCCTTATGCTTCTTGTGAAAACATGCCTGGTTCATACAAATGCTCGTGCATAGCTGGTTTCAAAGGTGATGGGCTTGTATGCGAAGACGTGGATGAGTGCGTCACAGAAAAGCGATGCCATGTTAATGCACTCTGTATAAATTCACCAGGGAAATACAACTGCAGCTGCATGGTGGGATATACAGGCAATGGTGTGTCGCAGTGCACAGATATAAATGAGTGTCTTGTTGATAATGGTGGCTGCAAAAACAGAGCAACATGTTCCAACAGTAAGGGGTCTTATTCTTGCATTTGCCCCTCAGGCTTTCGGCTAGTCAATCATACCACCTGCCAGGACATAGATGAATGTCAGCTTCCTGAAAAGGTTTGTGGCACCAACGAGCAGTGCACCAACCTGGAAGGATCATATTCATGCCAGTGTAAAGCAGGTTTCAGTCGAATCATTGATGACTTCTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 304 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8193942)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496462
GRCz11 13 8828485
KASP Assay ID:
2260-6052.1 (used for ordering genotyping assays)
KASP Sequence:
CTTGTGAAAACATGCCTGGTTCWTACAAATGCTCGTGCATAGCTGGTTTC[A/T]AAGGTGATGGRCTTGTATGCGAAGACGTGGATGAGTGCRTCACAGAAAAG
Long Flanking Sequence:
ACACCTGCCTCTGTAACAGTGGCTATCAAAGCAATGGACAGACATGTGTGGACATCAATGAATGTCAAATCAACTTCTGCAGCCCATTTGCTGATTGTACTAACTTGCCAGGCTCATATCGATGCACCTGTCCTGAAGGATTTAATGGAAACGGCTTGGCATGTGTAGACATCAATGAGTGTGATAGAAAGAACAGCTGTGACCCCAATGCATTATGTACAAATCTGCTTGGAAGCTACAAATGTTCCTGCCGCTCTGGGTTCCTGGGTATTGGTACAAAGTGCACTGACATTAATGAATGTGCCACCGATAACATTTGCCCAGCCGTTGCTGCATGTGTCAACACAGCAGGTTCATTCTTCTGTGACTGTGGTCAAGGGTATAACTTTACTCAAAATCAGTGTGTAGATTTGGATGAATGTGCCATAGGACTTTGCAGTCCTTATGCTTCTTGTGAAAACATGCCTGGTTCATACAAATGCTCGTGCATAGCTGGTTTC[A/T]AAGGTGATGGGCTTGTATGCGAAGACGTGGATGAGTGCGTCACAGAAAAGCGATGCCATGTTAATGCACTCTGTATAAATTCACCAGGGAAATACAACTGCAGCTGCATGGTGGGATATACAGGCAATGGTGTGTCGCAGTGCACAGATATAAATGAGTGTCTTGTTGATAATGGTGGCTGCAAAAACAGAGCAACATGTTCCAACAGTAAGGGGTCTTATTCTTGCATTTGCCCCTCAGGCTTTCGGCTAGTCAATCATACCACCTGCCAGGACATAGATGAATGTCAGCTTCCTGAAAAGGTTTGTGGCACCAACGAGCAGTGCACCAACCTGGAAGGATCATATTCATGCCAGTGTAAAGCAGGTTTCAGTCGAATCATTGATGACTTCTGCTCTGATATTAACGAATGTGACATTCAGAAACCTTGTCATCAAAATGCCACATGCTTGAATTTGGTAGGCTCCTACTCATGTACCTGCAAAAGTGGCTTCAAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1273
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 447 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8193511)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496031
GRCz11 13 8828054
KASP Assay ID:
554-1188.1 (used for ordering genotyping assays)
KASP Sequence:
ATTGATGACTTCTGCTCTGATATTAACGAATGTGACATTCAGAAACCTTG[T/A]CATCAAAATGCCACATGCTTGAATTTGGTAGGCTCCTACTCATGTACCTG
Long Flanking Sequence:
CTTTGCAGTCCTTATGCTTCTTGTGAAAACATGCCTGGTTCATACAAATGCTCGTGCATAGCTGGTTTCAAAGGTGATGGGCTTGTATGCGAAGACGTGGATGAGTGCGTCACAGAAAAGCGATGCCATGTTAATGCACTCTGTATAAATTCACCAGGGAAATACAACTGCAGCTGCATGGTGGGATATACAGGCAATGGTGTGTCGCAGTGCACAGATATAAATGAGTGTCTTGTTGATAATGGTGGCTGCAAAAACAGAGCAACATGTTCCAACAGTAAGGGGTCTTATTCTTGCATTTGCCCCTCAGGCTTTCGGCTAGTCAATCATACCACCTGCCAGGACATAGATGAATGTCAGCTTCCTGAAAAGGTTTGTGGCACCAACGAGCAGTGCACCAACCTGGAAGGATCATATTCATGCCAGTGTAAAGCAGGTTTCAGTCGAATCATTGATGACTTCTGCTCTGATATTAACGAATGTGACATTCAGAAACCTTG[T/A]CATCAAAATGCCACATGCTTGAATTTGGTAGGCTCCTACTCATGTACCTGCAAAAGTGGCTTCAAGGGAAATGGTGTAACATGCGAAGACATAAATGAATGTGCACTTGGTGGTATATGCCATCTACATGCTAATTGCTACAATTATATTGGGGAATACTTGTGTGTATGCCACCAGGGTTTTACAGGTGATGGTGTCACCTGTACAGATGTAGATGAATGTTATGTTTCAAATGCTACTTGCCCAGGAATCTCTGTATGTGTCAATTCGTTGGGAGCATATGTCTGTTCGTGTCTGAACGGGACAGTAGCATACAACAACACCTGTGTCTTCCCTAGTCTTGAATGTGATCCTGCCTGCCATCCGCATGGACTCTGCCATCCGTCACCTTCTGGCTTTCAATGTGTGTGTGATGTTGGATTCAAAGGGGATGGACTCACTTGCTCAGACATTGATGAATGTGAAGAGAATGTGTGCCCAGAGAAAGAGACACAATGTGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3844
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 612 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8193018)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8495538
GRCz11 13 8827561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCAGACATTGATGAATGTGAAGAGAATGTGTGCCCAGAGAAAGAGACA[C/T]AATGTGTCAATAATCCAGGMTCTTTTGAATGCACATGCAAAGAGGGYTAT
Long Flanking Sequence:
AACCTTGTCATCAAAATGCCACATGCTTGAATTTGGTAGGCTCCTACTCATGTACCTGCAAAAGTGGCTTCAAGGGAAATGGTGTAACATGCGAAGACATAAATGAATGTGCACTTGGTGGTATATGCCATCTACATGCTAATTGCTACAATTATATTGGGGAATACTTGTGTGTATGCCACCAGGGTTTTACAGGTGATGGTGTCACCTGTACAGATGTAGATGAATGTTATGTTTCAAATGCTACTTGCCCAGGAATCTCTGTATGTGTCAATTCGTTGGGAGCATATGTCTGTTCGTGTCTGAACGGGACAGTAGCATACAACAACACCTGTGTCTTCCCTAGTCTTGAATGTGATCCTGCCTGCCATCCGCATGGACTCTGCCATCCGTCACCTTCTGGCTTTCAATGTGTGTGTGATGTTGGATTCAAAGGGGATGGACTCACTTGCTCAGACATTGATGAATGTGAAGAGAATGTGTGCCCAGAGAAAGAGACA[C/T]AATGTGTCAATAATCCAGGATCTTTTGAATGCACATGCAAAGAGGGTTATTCTTTCAATGGAACCAAATGCACAGGTAGGTGCATTTTTAATTAATTGTTGATTATTAATTATGTTTTTATTAAACATTTAGCCTGAAAACTATCTTGAATGCACTGTAAACCAATAAAGGAAAAAGGTCTATTGAGTCAAAAATGATATCTCTCAATCTTTCAGATTTGGATGAATGTGAATCTGGAGTCAGCAACTGCAGCAAGTTTGCACAGTGTGTCAATACAGTTGGGAGTCACCTGTGCTTCTGTCTCAGTGGCTTCACTGGTGATGGAAAAAACTGCTCTGGTAAGTCTCTCTTCCTTTTCGAAATTCTTTTGTGCACGTCTTTGCTTGCTTGAAGACTTTTTTCTTAGTCTTTTAGGGATTGTTTTCCTCACCCTGTCCCATTTTGGATGACTTATAGACATTAATGAGTGCCACTTCCAAAATGGAGGATGCCATCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 718 1315 3 3
Genomic Location (Zv9):
Chromosome 13 (position 8192442)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8494962
GRCz11 13 8826985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCAAGTGCACCTGTCCGCTTGGCATGACCGGGTCTGGGTTTGATTGT[C/T]AGGATGTGGACGAATGCAACGCAAACTCAACTTTGCCTCATAACTGCAGT
Long Flanking Sequence:
GTAGGTGCATTTTTAATTAATTGTTGATTATTAATTATGTTTTTATTAAACATTTAGCCTGAAAACTATCTTGAATGCACTGTAAACCAATAAAGGAAAAAGGTCTATTGAGTCAAAAATGATATCTCTCAATCTTTCAGATTTGGATGAATGTGAATCTGGAGTCAGCAACTGCAGCAAGTTTGCACAGTGTGTCAATACAGTTGGGAGTCACCTGTGCTTCTGTCTCAGTGGCTTCACTGGTGATGGAAAAAACTGCTCTGGTAAGTCTCTCTTCCTTTTCGAAATTCTTTTGTGCACGTCTTTGCTTGCTTGAAGACTTTTTTCTTAGTCTTTTAGGGATTGTTTTCCTCACCCTGTCCCATTTTGGATGACTTATAGACATTAATGAGTGCCACTTCCAAAATGGAGGATGCCATCCAGTTGCAAGCTGCACTAACTCCCCTGGATCCTTCAAGTGCACCTGTCCGCTTGGCATGACCGGGTCTGGGTTTGATTGT[C/T]AGGATGTGGACGAATGCAACGCAAACTCAACTTTGCCTCATAACTGCAGTCTCCTCTCCACATGCCATAACACAGAGGGTTCCTACATTTGCAAGTGCATGGAGGGATACTGGGGAAATGGGTTTACTTGTAGTGATCTGGATGAGTGCTTTCCACCTTCAATCTGTGGGAACAACATGACCTGTCAAAACTTCCCTGGAACATTTACCTGCACATGCACCCTTGGTTTGGTCTATGATCTGGGTACCTGTGTGACTGAGAAGGACTGTAAGAATGCAACTAATGCATGCAACATCTATGCTGAGTGCAAAAACGTCCATGGGTCAAACTATTGCTCTTGCATGAAAGGATTCCATGGAAATGGTAGAGACTGCAAGGATTTAGATGAATGTTCACAAATAGGAGCTTGCCCAAATTTGTCCAACTGTTTTAACACAGAAGGATCATTTCATTGTGACTGCTTGCAAGGTTACCAGTACAATGGGACACACTGTGATGAC
Associated Phenotype:
Not determined