Busch Lab

ZMP

LOC100151213

Ensembl ID:
ENSDARG00000087536
Human Orthologue:
ZNF407
Human Description:
zinc finger protein 407 [Source:HGNC Symbol;Acc:19904]
Mouse Orthologue:
Zfp407
Mouse Description:
zinc finger protein 407 Gene [Source:MGI Symbol;Acc:MGI:2685179]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13348 Nonsense Available for shipment Available now
sa19130 Nonsense Mutation detected in F1 DNA Not yet available
sa10913 Nonsense Available for shipment Available now
sa45563 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42656 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13348
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 137 1389 1 8
Genomic Location (Zv9):
Chromosome 16 (position 7946877)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6792609
GRCz11 16 6733287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGGTGCATCTGGAGAGTTCTTCAGTGTCTCTGTCAGAAGAGGACAAA[C/T]AATCGGATTGCTGCGTGGATGAAAACTCKGTGAAGGTTGTTGGAAACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19130
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 623 1389 1 8
ENSDART00000124065 Nonsense 623 1389 1 8
Genomic Location (Zv9):
Chromosome 16 (position 7948335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6794067
GRCz11 16 6734745
KASP Assay ID:
2260-9178.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGTGAGGAGAATTGTAATAACGAGAATGGAGAAAAGCAGTCTGACGAA[C/T]AGAGTACCTCTAAAGATAACGAAGAATCAGATCCAACCGTTTCTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10913
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 623 1389 1 8
ENSDART00000124065 Nonsense 623 1389 1 8
Genomic Location (Zv9):
Chromosome 16 (position 7948335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6794067
GRCz11 16 6734745
KASP Assay ID:
2260-9178.1 (used for ordering genotyping assays)
KASP Sequence:
TAARTGAGGAGAATTGTAATAACGAGAATGGAGAAAAGCAGTCTGACGAA[C/T]AGAGTACCTCTAAAGATAACGAAGAATCAGATCCAACCGTTTCTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Essential Splice Site 876 1389 2 8
Genomic Location (Zv9):
Chromosome 16 (position 7950868)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6796600
GRCz11 16 6737278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTAATTTAAAGAGGAAAATTGAATGTCTTTTTAAAATTGTTTTTTTC[A/T]GGATCTAAACCGTTCAGGTGCAAGATCTGCAACTTTTCCACTGCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42656
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 1188 1389 8 8
Genomic Location (Zv9):
Chromosome 16 (position 7959351)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6805083
GRCz11 16 6745761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGGTGGCCATCGATCAGGCTCTGGAGCAGTCGGCCGCTGCCACTTTA[C/T]AGACCCTCGCCATGTCCAGCCAGCTGGCCGAAGTGCTGCACATCACCGAG
Associated Phenotype:
Not determined