Busch Lab

ZMP

si:ch211-278p9.1

Ensembl ID:
ENSDARG00000087532
ZFIN ID:
ZDB-GENE-081028-46
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105963 Nonsense 542 1120 3 8
ENSDART00000144492 Nonsense 422 477 1 1
Genomic Location (Zv9):
Chromosome 17 (position 7291976)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7294750
GRCz11 17 7451928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACTGAGATCTTTAAGGAGGAATCTGTGATTCATCAGAGGAAAGTCTA[C/A]AGCTTCATTCATTTGAGCTTTCAAGAATTTCTCGCTGCTCTATTTCTGTT
Associated Phenotype:
Not determined