Busch Lab

ZMP

ENSDARG00000087434

Ensembl ID:
ENSDARG00000087434

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10187 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26874
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127931 Essential Splice Site 3 191 2 2
Genomic Location (Zv9):
Chromosome 7 (position 6029584)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5064102
GRCz11 7 5185982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAAATGTACACCTTAAAATAATTTTTAATATTATTCTCTTTTTTTTA[A/T]GAGCTGTGGATGCAAAAGGATCAGCAGAAGAAGCGGAGGCTGAAGCTGAA
Long Flanking Sequence:
TTCAACAGTCAATCTACGTTCCTACTCTCACCTATGGTCATGAGCTTTGGGGCATGACTAAAAGGACAAGATCTCGGATACAAGCAGCCGAAATAAGTTTCCTTTGCAGGGTGGCAGGGCACACTCTTATGGATAGGGTGACGTGCTCTGACACCTGGGAGGAGCTTGGCTTAGAGCCACTGCTCCTCCACATCGAGAGAAGTCAGCTGAGGTGGCTCCTGGACACCTACCTAGGGAGGCGTTCTAGGCATGTCCCACAGGGAGGAGGCCGCGGGGAAGAACCAGGACACGCTGGAGTTACTATGTCTCTTGGCTGGCCTGGGAATGCCTCGGGATGCCCCCCGGAGGAGCTGGAGGAAGTGTTTGGGAAAAAGGGAATTCTGGAGTTCTCTCCTAAGACTGCTGCCCCTGCGACCCGGCCACGGAGAAGCGATAAAAAAAGAATTAATGAATGAAATGTACACCTTAAAATAATTTTTAATATTATTCTCTTTTTTTTA[A/T]GAGCTGTGGATGCAAAAGGATCAGCAGAAGAAGCGGAGGCTGAAGCTGAATGAGGAGGACCAGCAGGAGTACTTGGAGGAACTGCGGTCGCAGGAGGAGCAGCATCAGGAGTTGCAAAAGGATTTGCAGGATGAGATGCGGTTGCTGAATGAGGCTGCAGAGATTCAGGAGGAGGAGCGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTCGCAGGAGGAGCAGGAGCGGGAGTTTTGGCAGGATGTGGCGGATGAGATGCGGTTGCAGAGTGAGGCTGTGGAGGAGGGGGAGGAAGAGAGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTGGCAGAAGGAGCAGGAGTTGCAGGAGAATTTGCAGGATGAGATACGGTCTCTGAATGAGGCTGCGGAGGAGCAGAAGGAAGAGCGCAGGCTGGAGTTACAGGAATTTCTGAGGTCACAGGAAGAGCAGGAGCAGGAGTTTTGGCAGGATGTGGCGGATGAAATACGGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10187
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127931 Nonsense 90 191 2 2
Genomic Location (Zv9):
Chromosome 7 (position 6029321)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5063839
GRCz11 7 5185719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGGAGCAGGAGCGGGAGTTTTGGCAGGATGTGGCGGATGAGATGCGGT[T/A]GCAGAGTGAGGCTGTGRAGGAGGGRGARGAAGAGAGCAGGCTGGAGTTTC
Long Flanking Sequence:
GGAGGCCGCGGGGAAGAACCAGGACACGCTGGAGTTACTATGTCTCTTGGCTGGCCTGGGAATGCCTCGGGATGCCCCCCGGAGGAGCTGGAGGAAGTGTTTGGGAAAAAGGGAATTCTGGAGTTCTCTCCTAAGACTGCTGCCCCTGCGACCCGGCCACGGAGAAGCGATAAAAAAAGAATTAATGAATGAAATGTACACCTTAAAATAATTTTTAATATTATTCTCTTTTTTTTAAGAGCTGTGGATGCAAAAGGATCAGCAGAAGAAGCGGAGGCTGAAGCTGAATGAGGAGGACCAGCAGGAGTACTTGGAGGAACTGCGGTCGCAGGAGGAGCAGCATCAGGAGTTGCAAAAGGATTTGCAGGATGAGATGCGGTTGCTGAATGAGGCTGCAGAGATTCAGGAGGAGGAGCGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTCGCAGGAGGAGCAGGAGCGGGAGTTTTGGCAGGATGTGGCGGATGAGATGCGGT[T/A]GCAGAGTGAGGCTGTGGAGGAGGGGGAGGAAGAGAGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTGGCAGAAGGAGCAGGAGTTGCAGGAGAATTTGCAGGATGAGATACGGTCTCTGAATGAGGCTGCGGAGGAGCAGAAGGAAGAGCGCAGGCTGGAGTTACAGGAATTTCTGAGGTCACAGGAAGAGCAGGAGCAGGAGTTTTGGCAGGATGTGGCGGATGAAATACGGTTGCAGAGTGAGGCTGTGGAGGAGGAGGAGGAGGAAGAGGGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTGGTAGAAGGAGCAGGATCAGGAGTTGCAGAAGGATTAGCAGGATAAAATAAGGTTGCTGTATGAGGCTGTGGAGGAGAAGGGTGAGGAGCGCAGGCTGGAGTTTTAGGAGTTTCTGAGGTCGCAGGAGTAGGAGTTTTAACAGGATGTGCAGAATGAGATGCGGTTGGAGATTTAGCAGCAGGAACTTTGATAAGAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8255
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127931 Nonsense 160 191 2 2
Genomic Location (Zv9):
Chromosome 7 (position 6029112)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5063630
GRCz11 7 5185510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTRCARGAATTTCTGAGGTCACAGGAAGAGCAGGAGCAGGAGTTTTGG[C/T]AGGATGTGGCGGATGARRTRCGGTTGCAGAGTGAGGCTGTGGAGGAGGAN
Long Flanking Sequence:
AATTTTTAATATTATTCTCTTTTTTTTAAGAGCTGTGGATGCAAAAGGATCAGCAGAAGAAGCGGAGGCTGAAGCTGAATGAGGAGGACCAGCAGGAGTACTTGGAGGAACTGCGGTCGCAGGAGGAGCAGCATCAGGAGTTGCAAAAGGATTTGCAGGATGAGATGCGGTTGCTGAATGAGGCTGCAGAGATTCAGGAGGAGGAGCGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTCGCAGGAGGAGCAGGAGCGGGAGTTTTGGCAGGATGTGGCGGATGAGATGCGGTTGCAGAGTGAGGCTGTGGAGGAGGGGGAGGAAGAGAGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTGGCAGAAGGAGCAGGAGTTGCAGGAGAATTTGCAGGATGAGATACGGTCTCTGAATGAGGCTGCGGAGGAGCAGAAGGAAGAGCGCAGGCTGGAGTTACAGGAATTTCTGAGGTCACAGGAAGAGCAGGAGCAGGAGTTTTGG[C/T]AGGATGTGGCGGATGAAATACGGTTGCAGAGTGAGGCTGTGGAGGAGGAGGAGGAGGAAGAGGGCAGGCTGGAGTTTCAGGAGTTTCTGAGGTGGTAGAAGGAGCAGGATCAGGAGTTGCAGAAGGATTAGCAGGATAAAATAAGGTTGCTGTATGAGGCTGTGGAGGAGAAGGGTGAGGAGCGCAGGCTGGAGTTTTAGGAGTTTCTGAGGTCGCAGGAGTAGGAGTTTTAACAGGATGTGCAGAATGAGATGCGGTTGGAGATTTAGCAGCAGGAACTTTGATAAGAGATACAGGATGAGTAGCAGCAGTTAAAAAAAGCAAGATGTCCTCGCTTCAGTCTGTAGCATAATTATGTACTGGATCAGATCCAATTCGTAGTGGACATTGTAACGCAAACTATGGTAATACCCATGCTACTAAGATAGTTGGGTTTAGGGTTAGGGTAGGAGTGGAGGTTAATAACTGTAAGGGTAGGGCTTAAGTGTAGACTTTAATAA
Associated Phenotype:
Not determined