Busch Lab

ZMP

taar12g

Ensembl ID:
ENSDARG00000087419
ZFIN ID:
ZDB-GENE-041014-64
Description:
trace amine associated receptor 12g [Source:RefSeq peptide;Acc:NP_001076377]
Human Orthologue:
TAAR2
Human Description:
trace amine associated receptor 2 [Source:HGNC Symbol;Acc:4514]
Mouse Orthologues:
Taar2, Taar3
Mouse Descriptions:
trace amine-associated receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2685071]
trace amine-associated receptor 3 Gene [Source:MGI Symbol;Acc:MGI:3527427]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23803 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23803
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123162 Nonsense 219 337 2 2
ENSDART00000143887 Nonsense 216 336 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46256732)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46165241
GRCz11 20 46068961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCTGTTCTCGCATTTTTTCTTCCTGGGGCCATCATGAGCTCTCTGTA[T/A]ATGAAAATCTTCCATGTTGCACGAAAACAAGCAAAGGTTATCTCAGAAAG
Long Flanking Sequence:
CTGATCATCATCTCCATCTCTCACTTCAAACATCTGCAGTCTCCAACTCATCTGATCGTTCGCTCTCTGGCTGCCTGTGATTGTTTGTTGGGTTCTTTAGTCATGCCGAACAGCATGGTGCGATCTGTTGAAGGCTGCTGGTATCTGGGAGATGTTGTGTGTAAAGTTCATTCTAGTTTGGACATGACCTTATGTATCTCATCTTTACTGCATCTTGGTTTAATATCTGTGGACAGGTATCTGGCCATTTGTGACCCTCTAAGATACAGAATAAGGGTCACAAACACCACTGTGACTGTATTTACTGTCTTCATATGGCTGTTTTCAGTTGTATACAGCTTTTATGTTAAATTTTCAGGAATAACTGCAGTTGGACTTGAGATGCTTATATTGCAGACTTACTGCGTGGGACGTTGTGTTGTATTTTTTAACAAACAATGGGGTCTTATATGTCCTGTTCTCGCATTTTTTCTTCCTGGGGCCATCATGAGCTCTCTGTA[T/A]ATGAAAATCTTCCATGTTGCACGAAAACAAGCAAAGGTTATCTCAGAAAGAGTGACTGGAGGGTTGAAGAGCCAAAGCTCTGCTCAGAGAGAGAGAAAAGCAGCTAAAACTCTGGCCATTGTCATGGGGGTCTTCTTGTTCTGCTGGATGCCTTTTTTCACTCTTACTGCTCTCGACCCTTTTTTTAACTTTTTAAGTTCTGCTGATGTATTTGATGCTTTATTCTGGTTTGCATATTTAAACTCCGCTTGTAACCCTTTGATTTATGGATTTTTCTATCCTTGTTTTCAGAAAGCCTTCAAGATTCTCATATTCACTTATATCTGTGGGGTCAAGAAGGCAAACACTTTAACATTTGAATGAATACAGTTTACCCAAATAAATCAGGAATCAATAAATATTTATTTTTTTGTACGTTTTATAAATTTATTTGATTACATATGCTGAAACAATTTTACACATTTATTTTACTATTTTATTTTGAATATTCTGCATCTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29456
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123162 Nonsense 298 337 2 2
ENSDART00000143887 Nonsense 295 336 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46256969)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46165004
GRCz11 20 46068724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTTTTAAGTTCTGCTGATGTATTTGATGCTTTATTCTGGTTTGCATA[T/G]TTAAACTCCGCTTGTAACCCTTTGATTTATGGATTTTTCTATCCTTGTTT
Long Flanking Sequence:
TATCTGGCCATTTGTGACCCTCTAAGATACAGAATAAGGGTCACAAACACCACTGTGACTGTATTTACTGTCTTCATATGGCTGTTTTCAGTTGTATACAGCTTTTATGTTAAATTTTCAGGAATAACTGCAGTTGGACTTGAGATGCTTATATTGCAGACTTACTGCGTGGGACGTTGTGTTGTATTTTTTAACAAACAATGGGGTCTTATATGTCCTGTTCTCGCATTTTTTCTTCCTGGGGCCATCATGAGCTCTCTGTATATGAAAATCTTCCATGTTGCACGAAAACAAGCAAAGGTTATCTCAGAAAGAGTGACTGGAGGGTTGAAGAGCCAAAGCTCTGCTCAGAGAGAGAGAAAAGCAGCTAAAACTCTGGCCATTGTCATGGGGGTCTTCTTGTTCTGCTGGATGCCTTTTTTCACTCTTACTGCTCTCGACCCTTTTTTTAACTTTTTAAGTTCTGCTGATGTATTTGATGCTTTATTCTGGTTTGCATA[T/G]TTAAACTCCGCTTGTAACCCTTTGATTTATGGATTTTTCTATCCTTGTTTTCAGAAAGCCTTCAAGATTCTCATATTCACTTATATCTGTGGGGTCAAGAAGGCAAACACTTTAACATTTGAATGAATACAGTTTACCCAAATAAATCAGGAATCAATAAATATTTATTTTTTTGTACGTTTTATAAATTTATTTGATTACATATGCTGAAACAATTTTACACATTTATTTTACTATTTTATTTTGAATATTCTGCATCTAATTATTTACATGCAGTGGTTCAGTCTATAGGATTGTTGAAAGACTCAAAAGCATGATGGTGTAAAAATGTATTTATTTGATTATTTATTGTTTTTTTAATTATTCATCTATAGTCACTTATATCAATGACAGAATTAAGAGCAATAAGAATAGCAACATATGTGAGAAATCATTGTTATTGTGTGACTAATTAGTACTGCAATATGCAGCAGTTCAATGTTAATGTTAATTCAAAAGTA
Associated Phenotype:
Not determined