Busch Lab

ZMP

si:ch73-85k9.1

Ensembl ID:
ENSDARG00000087394
ZFIN ID:
ZDB-GENE-070705-244
Description:
Novel protein similar to H.sapiens teashirt family zinc finger [Source:UniProtKB/TrEMBL;Acc:A5WWF5]
Human Orthologue:
TSHZ3
Human Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Mouse Orthologue:
Tshz3
Mouse Description:
teashirt zinc finger family member 3 Gene [Source:MGI Symbol;Acc:MGI:2442819]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6506 Nonsense Mutation detected in F1 DNA Not yet available
sa25058 Nonsense Mutation detected in F1 DNA Not yet available
sa23256 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6506
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125979 Nonsense 467 946 2 4
ENSDART00000142462 Nonsense 411 964 1 1
Genomic Location (Zv9):
Chromosome 18 (position 14319518)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14764936
GRCz11 18 14733448
KASP Assay ID:
554-4909.1 (used for ordering genotyping assays)
KASP Sequence:
CATCCATTGCAACTGGAGACCACAAGANNNNNNCACAAGAAATTACCTCT[C/T]AGAAAAGCAGTGAGTCCAAGGAGTCTGCAAATGTAAATGATGTTAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25058
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125979 Nonsense 541 946 2 4
ENSDART00000142462 Nonsense 485 964 1 1
Genomic Location (Zv9):
Chromosome 18 (position 14319294)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14764712
GRCz11 18 14733224
KASP Assay ID:
554-7750.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAGGGTGCCCCGAGCTGGGGTGGTTACCAGAGCATTCATGCAGCTTA[T/A]CAGTTACGAAACCATTTAAAGCCTGCTCTGCACAACCCAGGCTATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125979 Nonsense 756 946 3 4
ENSDART00000142462 Nonsense 711 964 1 1
Genomic Location (Zv9):
Chromosome 18 (position 14318618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14764036
GRCz11 18 14732548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATTCCAACTGCCATGAAATTTGCAGAGACCAGCCGATAGACTTGTCC[A/T]AAGGTAAAAATGAACAGTACCTTACAACTGCCTCTGTCCCAGGCAAAGCT
Associated Phenotype:
Not determined