Busch Lab

ZMP

zgc:66473

Ensembl ID:
ENSDARG00000087375
ZFIN ID:
ZDB-GENE-030131-5708
Description:
hypothetical protein LOC327497 [Source:RefSeq peptide;Acc:NP_956108]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7056 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7056
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129312 Essential Splice Site 4 398 1 2
Genomic Location (Zv9):
Chromosome 7 (position 3046060)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2622117
GRCz11 7 2430179
KASP Assay ID:
554-4833.1 (used for ordering genotyping assays)
KASP Sequence:
TCTSCTGTGAGGTGGACAGATTTAATCCAGAGATCACCATGGATTCAAGG[T/A]GAGTTTTTTTCTTGATTTAGTTTTGTTAAATTTTGCTCCAGATAGCATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18861
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129312 Nonsense 22 398 2 2
Genomic Location (Zv9):
Chromosome 7 (position 3045035)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2621092
GRCz11 7 2429154
KASP Assay ID:
2259-8357.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCGAGTCCTTTACAACGCAAGCCAAGTTTGATTCAGCAAGGTCCTCCA[A/T]AAAGATTCCGTCTACATACAGAGAGGAAAATACTTGATGATAACGGGAAA
Associated Phenotype:
Not determined