Busch Lab

ZMP

si:dkeyp-46h3.6

Ensembl ID:
ENSDARG00000087363
ZFIN ID:
ZDB-GENE-060503-90
Description:
Novel protein containing a galactose binding lectin domain [Source:UniProtKB/TrEMBL;Acc:A3KQ75]
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36857 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45675 Nonsense Mutation detected in F1 DNA Not yet available
sa16907 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123155 Essential Splice Site 10 234 2 9
Genomic Location (Zv9):
Chromosome 19 (position 28049850)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27979962
GRCz11 19 27564185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTTTTTGTGCCAATGTAAGTTTGTTTGCTTATTTTTCTGCTCCCTTTC[A/G]GTGCTTATGGGCTGTAGCCTGTCTGCAGGTGTTACATTAAATCTAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45675
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123155 Nonsense 34 234 2 9
Genomic Location (Zv9):
Chromosome 19 (position 28049777)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27979889
GRCz11 19 27564112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGTGTTACATTAAATCTAGCTCCTCTAGATGCTGAGGTGTCGCCA[C/T]GAACTAGTAAGTGTACTTTTATTGTCATTTGCTTTAGTGCAACAAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123155 Nonsense 52 234 4 9
Genomic Location (Zv9):
Chromosome 19 (position 28048869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27978981
GRCz11 19 27563204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACAANNCGTTGATTTRTTAAATGTGGTTMTCTTTCTCCATGTAGCATA[T/A]GGTGTGCTTCAGATAACCGMCGCAAACTATGGACGTACTAATAGACRTGA
Associated Phenotype:
Not determined