Busch Lab

ZMP

ENSDARG00000087314

Ensembl ID:
ENSDARG00000087314

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44380 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa30358 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110893 Splice Site, Nonsense 433 607 12 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3514 (position 86633)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 60230620
GRCz11 4 63162045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACACACACACACAGCTGTGGTTATAAATGTGTGTGTTCTTGTGTTCAGA[T/A]GTCTGTTTCCTCACTCTGGATCCAAATACAGCACATACTCAACTTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110893 Nonsense 480 607 12 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3514 (position 86773)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 60230760
GRCz11 4 63161905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCCATATCCTGATCATCCAGACAGATTTGATGATCATCATCAGGTGT[T/A]GTGCAGAGAGAGTGTGTGTGGACGCTGTTATTGGGGGATTGACTGGAGTG
Associated Phenotype:
Not determined