Busch Lab

ZMP

si:ch1073-404h7.1

Ensembl ID:
ENSDARG00000087299
ZFIN ID:
ZDB-GENE-100922-67
Human Orthologue:
ARMC9
Human Description:
armadillo repeat containing 9 [Source:HGNC Symbol;Acc:20730]
Mouse Orthologue:
Armc9
Mouse Description:
armadillo repeat containing 9 Gene [Source:MGI Symbol;Acc:MGI:1926045]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24216 Nonsense Available for shipment Available now
sa43882 Nonsense Mutation detected in F1 DNA Not yet available
sa29834 Nonsense Mutation detected in F1 DNA Not yet available
sa24217 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29832
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Splice Site, Nonsense 96 532 4 17
ENSDART00000132181 Splice Site, Nonsense 80 516 3 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39469839)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36616612
GRCz11 22 36585621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACAGGCCTTCATCAGCAACGACCTTCTGGAGAGATACAGTAACAAA[C/T]AGGTACGTGGTGACACAACGATGACACAGGTCATATTTATGGTAACAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29833
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Essential Splice Site 127 532 5 17
ENSDART00000132181 Essential Splice Site 111 516 4 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39472931)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36619704
GRCz11 22 36588713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACAGTATACGGCCAGACTGATCAATGCGTTTGCCTCTTTGTGTGATGG[T/C]GAGTGAAAAGGATTCTTCGTTATATTGTTCTCTAAGCCCATCCAATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24216
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 144 532 6 17
ENSDART00000132181 Nonsense 128 516 5 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39475209)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36621982
GRCz11 22 36590991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTGTACCTGTCTCAGATTCCAGCTTTACTGCCATTTCTGCTGGACTG[T/A]CTGAAGACTGAAGAGAAAGAGTCTGTCACTCGAGAGAATGTGCTGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43882
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 249 532 9 17
ENSDART00000132181 Nonsense 233 516 8 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39479008)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36625781
GRCz11 22 36594790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTTTTTTGTGGGTTTTTTAGATTCGGTATTATGTGAATGGAGCTT[T/A]ATACAGCATCCTGTCTGTGCCAGAGATACGAGAGGAAGCCAAACAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 264 532 9 17
ENSDART00000132181 Nonsense 248 516 8 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39479052)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36625825
GRCz11 22 36594834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTATACAGCATCCTGTCTGTGCCAGAGATACGAGAGGAAGCCAAA[C/T]AGATGGTACGTGTTTAACAGCTTCATTCACAGTTACAGTTACGCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24217
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 525 532 16 17
ENSDART00000132181 Nonsense 509 516 15 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39506936)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36653709
GRCz11 22 36622718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGCAGCCGGCCCGGATCAGCAGGGGGCTCCAGTGGGCGACCGAGCCAA[C/T]AGAGTGAGTATTTCACCCAGCCTTCCCTCACAAACGGATACTCTTAAAGG
Associated Phenotype:
Not determined