Busch Lab

ZMP

si:dkey-23o10.3

Ensembl ID:
ENSDARG00000087298
ZFIN ID:
ZDB-GENE-030131-874
Description:
Novel protein similar to vertebrate actin binding LIM protein family, member 3 (ABLIM3, zgc:158673)
Human Orthologue:
ABLIM3
Human Description:
actin binding LIM protein family, member 3 [Source:HGNC Symbol;Acc:29132]
Mouse Orthologue:
Ablim3
Mouse Description:
actin binding LIM protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2442582]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa306 Nonsense Confirmed mutation in F2 line Not yet available
sa184 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa306
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052589 Nonsense 178 630 5 22
ENSDART00000060067 Nonsense 179 683 5 23
ENSDART00000136327 None None 132 None 6

The following transcripts of ENSDARG00000087298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 43577949)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34355919
GRCz11 14 34696233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATCTCTGCTGGCGTTGGAGAAGCAGTGGCACGTCAGCTGCTTCAGGTG[T/A]CAGACCTGCGGCCTCGTCCTGACCGGAGAGTATATCAGCAAGTGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa184
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052589 None None 630 None 22
ENSDART00000060067 Nonsense 330 683 10 23
ENSDART00000136327 None None 132 None 6

The following transcripts of ENSDARG00000087298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 43603215)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34336507
GRCz11 14 34676821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAAGGTTAAAGCCATTTATGAAGTGCAGAGGCCAGACTACTGGTCCTA[T/A]GAGTCGAGTCACAGATACTGCTCCGATGACAGGCTAGAGCGCCTCAGCTA
Associated Phenotype:
Not determined