Busch Lab

ZMP

NLRP6 (60 of 83)

Ensembl ID:
ENSDARG00000087251
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17747 Nonsense Available for shipment Available now
sa2922 Nonsense F2 line generated Not yet available
sa28935 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17747
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125772 Nonsense 307 1101 5 10
Genomic Location (Zv9):
Chromosome 17 (position 50830437)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50221254
GRCz11 17 50300323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACTCAGTTATTCCCAGAGRTCAAAGGACTGAACCTTACAAGAAGGACA[C/T]GAAACAAAGTCCTCTTCATCCTTGATGGATTGGATGAATGTMGYCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2922
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125772 Nonsense 384 1101 5 10
Genomic Location (Zv9):
Chromosome 17 (position 50830206)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50221023
GRCz11 17 50300092
KASP Assay ID:
554-3226.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCCAGTAAGATTCCCGCAGACTGTATTGACAGGCTGACAGAGATACGA[G/T]GATTCAATGATGCCCAAAAGGWGGAGTACTTCAGAAAGAGACTCGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28935
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125772 Nonsense 619 1101 5 10
Genomic Location (Zv9):
Chromosome 17 (position 50829501)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50220318
GRCz11 17 50299387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGACATCTGGATCTGTACCTTCGCTTCCTTCTTGGTTTATCGCTT[C/T]AGACCAATCGACAACTCCTACGAGGCCTGTTGACACAGCAGGACAAAAGT
Associated Phenotype:
Not determined