Busch Lab

ZMP

ENSDARG00000087197

Ensembl ID:
ENSDARG00000087197

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45597 Nonsense Mutation detected in F1 DNA Not yet available
sa11486 Nonsense Available for shipment Available now
sa8890 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45597
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 19 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108084)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258912
GRCz11 17 15266845
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGAGCACTGGGATATATCGCAGTCCTCTTCCAGACGTCTCTAGCCAA[C/T]AACAAGAGATAAGTCACATCATTAAAATGCCTTCTGTCTCCAACTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 45 275 1 3
ENSDART00000130160 Nonsense 45 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258832
GRCz11 17 15266765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTCTGTCTCCAACTTTGTGGTCAGTTTTCCTAATAAGAGAMTTGTYTA[T/A]CATGASAGAAGTGATCAAACGCTYAACGCCACATCKCTGGATGGATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8890
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 45 275 1 3
ENSDART00000130160 Nonsense 45 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258832
GRCz11 17 15266765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTCTGTCTCCAACTTTGTGGTCAGTTTTCCTAATAAGAGAMTTGTYTA[T/A]CATGASAGAAGTGATCAAACGCTYAACGCCACATCKCTGGATGGATTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4703
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 261 275 3 3
Genomic Location (Zv9):
Chromosome 17 (position 15105244)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15256072
GRCz11 17 15264005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATGGTGACATATTGAAGCAAGATTTGGATAACATTGAATTTATGGAA[C/T]AAATTGTGTCTTTGATTGGAGATGTGAAAGGTAAGAAACCAGAGACTCAT
Associated Phenotype:
Not determined