Busch Lab

ZMP

RORC

Ensembl ID:
ENSDARG00000087195
Description:
RAR-related orphan receptor C [Source:HGNC Symbol;Acc:10260]
Human Orthologue:
RORC
Human Description:
RAR-related orphan receptor C [Source:HGNC Symbol;Acc:10260]
Mouse Orthologue:
Rorc
Mouse Description:
RAR-related orphan receptor gamma Gene [Source:MGI Symbol;Acc:MGI:104856]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36093 Nonsense Available for shipment Available now
sa17968 Essential Splice Site Available for shipment Available now
sa13691 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7784
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Nonsense 108 480 4 11
Genomic Location (Zv9):
Chromosome 16 (position 20047894)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18078127
GRCz11 16 17984831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATTCACTATTTGCAGAAGTTGAGAGACATCGCCAGCATCAGCGTCTT[C/T]AAGCCAACTCAGTCCAGGAGCCCCAACCTCTCCAAGCCTACCGATCCAGC
Long Flanking Sequence:
AAATTTTCAGTGAAAAGTAAATTTTGTTTCAAGTTGATAATGCACATTTTAAAAGAAAGCTGCTTGGTATGCTAATGACTTTTGTGTGAGCAGTGCTTAAAGAACATTGAAATTTCTTTAGACTGGATGTTATGTTACCAAAAATCTGCCCTGATAATTGTTTTTTTTTTTCCACAACCGTGACAGGGTTTCTTTCGCAGAAGTCAGTCCTCTAGCGTGCAGTACTCATGCTCCAGACAAAGCAATTGCCCCATTGACCGTGCCAGCCGTAATCGTTGCCAGAGCTGCCGTCTAAAAAAATGTGTCGCTCAAGGAATGAGCCGAGATGGTTAGAAAGGATGATTGGATACTATTCTTGAATGACACAGAAACAAAATTTTGATAATCATTTTGTACTCGTTTTCTTGTCTCTATTAGCGGTGAAGTTTGGGCGAATGTCCAAGCGTCAGAGAGATTCACTATTTGCAGAAGTTGAGAGACATCGCCAGCATCAGCGTCTT[C/T]AAGCCAACTCAGTCCAGGAGCCCCAACCTCTCCAAGCCTACCGATCCAGCAAAGATACCAGAGAACAGCCATCACATCTCATCCCACCTCTACCGGCAGCCTACCCTTTTTCTGTAGAGCCAGAACTTGCAGGCTGCCCAGCAGAAGTAATTCCATACCTGGACTGTCACATAGTTGAGGCCCAGACTCAGGGTTTGGCCTATAGAGTCCCCCTCAGGAGAGGTGAGAACAACAGCTTGTCAGCTGGGAGAGGTGAGAATATGTCTAATTGATTGTACTTCCCTCTAAAGTAATATATACACATTTATTGAGATTTTTTAAACATTTTTTTCTTTCAGGATTTGAGTCCACAAGATCTACACCTGAGTCTATTCTGAACATGACTGGGAGTGAAATGGGGTTTCATCCTTTTGATCCTGAGAGCTCATTCTTTTCCTATCCAACCTCTCTACAAACAGGTGAGAAGAAGTTAGTTTACCCCGAAACACTTTTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Nonsense 243 480 6 11
Genomic Location (Zv9):
Chromosome 16 (position 20120029)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18150262
GRCz11 16 18056966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGGTTTTTGATAGAGGAGCTTGCTGCAAGTATTATACGCTCACAT[A/T]AAGAGACCACTCAGTATCGACTGGAAGAACTGCAGGCTCTCAGATGGAAG
Long Flanking Sequence:
TTTAAACTTCAAGTTGGTTGAACCTCTTTACTGAAACAGGCCCCTGGGGTACGCAAAGTTTTTGTGTGTACGCAGCGTTGATACATGAGGCCCCAGGACTGTAGATGACGTTCTGCAGTTGGATGAATGGATGTATCAAAAATTGTGCGCTAGATAATAGGAAGTTATTATTTTTTTTCAACAGGACAAAATAGTTTGAAGAACAACATGTCTGGATAACAAACTTCTCAATCTCCTGTATGGAAATTGGTCTGCAAAAAGAGAAAAAAAGCCTTTACTTTATGTTCAGTTAATCATAAATTATGTGTTTGCTCATGCTTAACTGATGCATAATTGTGAACAAGTTAATCATGATTTACAAGTTTACCTAAGCTTAATTAATGCATAATAAATGCATCACCCTTAAATGAAGGATTGGACTGTTAAGCATTCAAAATAACATATTTGTTTTTGTGTGGTTTTTGATAGAGGAGCTTGCTGCAAGTATTATACGCTCACAT[A/T]AAGAGACCACTCAGTATCGACTGGAAGAACTGCAGGCTCTCAGATGGAAGGTTTTCAGCAGGGAGGAGGTCCACATATACCAGAGCAAAGTACATGTTGTTTATTATTTTAGAACTACGCCAATTTTATATTCTATGTATATGTGTGTTTTTCCAAGTGGGCTATGCTCAATTTCTAATGAGAAATAAATAATTGATGCTATGCCCAATGAGGAATATTTGTTCTTCTTCAAACAATGTTGCCACCTAGAGGACAAACTATCAAAACAAAACATTCATTGCACATAAGCAACTTAAGCTCATACATTATGTGCAGTTAGAAAGGTCAGACTTCATGTATACATTACACTTTGTTCTTAACTGTGAGAACCATGTGAAAAACTGCAATATTAGTCACATATTTGTTTTTCTGCAGGAAGATCAATTGTAAAAAAGTTTCAAGTATGGTACATACATTTCTTAGACATACAATTTACTGTTAAATTATCTGGCATGAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Essential Splice Site 390 480 10 11
Genomic Location (Zv9):
Chromosome 16 (position 20150188)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18180421
GRCz11 16 18087125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTAAATTAGGATAGACTAACTCTCTTTTTATTCTCTGCATTTTTCAAT[A/C]GATCGACCATGTCTGGAGGACAGGGAAAGARTTCAGAGAGTAAGGACAGA
Long Flanking Sequence:
AGTTGGCGGTTCATTCTGCTGTGGCGACCTCGGATTTATAAAGGGACTAAGCCAAAAAGAAAATGAATGAATTGACATTCTTATAAACTGTCCTTTTAAAAGTGTACATAAGTGTATTTAGTACATGAGTGTATTTTTTTTTATTTTAAGAAATTTCTAGTACATTTTTTAAATTATACTTTTAGGATTTAAAGTGCACTTTCAGTACAATTAAGCACAATTTTTTGCAATCTACCCAAAATAAAATCAGCATGGTTCAACTCATTGTGTTTCTAATTGGTTTTATTATTTTTTTCTGCAGCATGTAGCGATCTAATAGCTGCAGTTTTTGAATTCGCTAACAATCTGTGTGCACTGAGACTGAATGAACAGCAGATGGCGGTGTTTACAGCAATGATCCTAATCAATCCAGGTAAGTAAAATAAGCCACATTACTACATAATTGTTTTATTTTAAATTAGGATAGACTAACTCTCTTTTTATTCTCTGCATTTTTCAAT[A/C]GATCGACCATGTCTGGAGGACAGGGAAAGAGTTCAGAGAGTAAGGACAGAAGTTGAGCTTGCCCTTAGACACATACTGCACAGAGATAATCAAGAGAGTCTACTGCAGAAGGTAAAAGAGGATGTAGATGGAACTGAGACAAAGATATGCATAAAGTGAAAACTTAAATCAGCTGGAATGGCTTTTAACTGGTAATTTTGTTTTTGTGTGATTGCAGCTGTATCAGAGAGTGCCGGTGTTGAGGTCTATGTGTGCACTGCATATTGAGAAACTGCAATGGTTCCGGCAGCTTTACCCTCTCACTGTTCATTCCCTTTTCCCTCCACTATACAAAGAGCTTTTTGGCTCTGACGCAGATATACATTCACTGACCACACACTAAACAAACACTGACACATTTCAGTTTCAGATATAGAAATGATATCATATCACATACAGTAGTGTATGCATTAAAGGTTTAAATATATTATTAACCTGATAAAATAAACATTCTTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Nonsense 430 480 11 11
Genomic Location (Zv9):
Chromosome 16 (position 20150415)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18180648
GRCz11 16 18087352
KASP Assay ID:
2260-9508.1 (used for ordering genotyping assays)
KASP Sequence:
AATGGCTTTTAACTGGTAATTTTGTTTTTGTGTGATTGCAGCTGTATCAG[A/T]GAGTGCCGGTGTWGAGGTCTATGTGTGCACTGCATATTGAGAAACTGCAW
Long Flanking Sequence:
CAATCTACCCAAAATAAAATCAGCATGGTTCAACTCATTGTGTTTCTAATTGGTTTTATTATTTTTTTCTGCAGCATGTAGCGATCTAATAGCTGCAGTTTTTGAATTCGCTAACAATCTGTGTGCACTGAGACTGAATGAACAGCAGATGGCGGTGTTTACAGCAATGATCCTAATCAATCCAGGTAAGTAAAATAAGCCACATTACTACATAATTGTTTTATTTTAAATTAGGATAGACTAACTCTCTTTTTATTCTCTGCATTTTTCAATAGATCGACCATGTCTGGAGGACAGGGAAAGAGTTCAGAGAGTAAGGACAGAAGTTGAGCTTGCCCTTAGACACATACTGCACAGAGATAATCAAGAGAGTCTACTGCAGAAGGTAAAAGAGGATGTAGATGGAACTGAGACAAAGATATGCATAAAGTGAAAACTTAAATCAGCTGGAATGGCTTTTAACTGGTAATTTTGTTTTTGTGTGATTGCAGCTGTATCAG[A/T]GAGTGCCGGTGTTGAGGTCTATGTGTGCACTGCATATTGAGAAACTGCAATGGTTCCGGCAGCTTTACCCTCTCACTGTTCATTCCCTTTTCCCTCCACTATACAAAGAGCTTTTTGGCTCTGACGCAGATATACATTCACTGACCACACACTAAACAAACACTGACACATTTCAGTTTCAGATATAGAAATGATATCATATCACATACAGTAGTGTATGCATTAAAGGTTTAAATATATTATTAACCTGATAAAATAAACATTCTTGCAACTCCTAAAAAAACATAATGTCTATTGTCTACCGTTTAGTGTAATTTCTAATCAAAATATCTCACTTTGATTATTCTAAAACATTATATATTTGAATGTTTTTTGAAAGACCTTTAATCCTTACAATAAAACTTTACTGCTTATAAAGATATTGATATGACCAAATACACAATTAAAGATTTCAAATCTCTGTCAAATATAGTGAGTTCAGGAACTGGCATCTTTGAACT
Associated Phenotype:
Not determined