Busch Lab

ZMP

si:ch211-86k6.4

Ensembl ID:
ENSDARG00000087110
ZFIN ID:
ZDB-GENE-091204-370
Human Orthologue:
AKNA
Human Description:
AT-hook transcription factor [Source:HGNC Symbol;Acc:24108]
Mouse Orthologue:
Akna
Mouse Description:
AT-hook transcription factor Gene [Source:MGI Symbol;Acc:MGI:2140340]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa37255 Essential Splice Site Available for shipment Available now
sa39322 Nonsense Mutation detected in F1 DNA Not yet available
sa12466 Essential Splice Site Available for shipment Available now
sa9769 Essential Splice Site Available for shipment Available now
sa43603 Nonsense Mutation detected in F1 DNA Not yet available
sa11369 Nonsense Available for shipment Available now
sa43602 Nonsense Mutation detected in F1 DNA Not yet available
sa43601 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43600 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 118 1452 2 23
ENSDART00000140413 None None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12164930)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13866104
GRCz11 21 13962833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACCGCTCTCTCAGGCCACTGGAGACCACTACTACTCTCCATCACTGC[G/T]TAAAAGGCTCAGTTTAATTAAACATCCATAACTAATTTTACAAATATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39322
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 336 1452 3 23
ENSDART00000140413 None None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12162513)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13863687
GRCz11 21 13960416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCCCTGAAAAAATATACCAAGATGCTACGAGTGGCGAAAAATTAGAT[G/T]GAAGGTTACACAGGCCTTACCACAATCTGCAGCCTCCAACAGTCTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 692 1452 None 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12147568)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13848742
GRCz11 21 13945471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGCTGCAGCAACNNNAAGGCRGACATGCCATCTTTGACCCAGACAGG[T/C]AGCCATTTTTTAAATGTTGGTGTACAGATATTGTAAAAAACAGAAATGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19256
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12145961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13847135
GRCz11 21 13943864
KASP Assay ID:
2261-5376.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCAGATGTCCTTTCTGCATCCATGCTGGAGCCTGAACCAGTGCCTGAG[G/A]TTCCTCAAAATTACTCCTAAACATCACTCACATATGACCTCATGGGTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4940
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12145961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13847135
GRCz11 21 13943864
KASP Assay ID:
2261-5376.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCAGATGTCCTTTCTGCATCCATGCTGGAGCCTGAACCAGTGCCTGAG[G/A]TTCCTCAAAATTACTCCTAAACATCACTCACATATGACCTCATGGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12145961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13847135
GRCz11 21 13943864
KASP Assay ID:
2261-5376.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCAGATGTSCTTTCTGCATCCATGCTGGAGCCTGAACCAGTGCCTGAG[G/A]TTCCTCAAAATKACTCCTAAACATCACTCACATATGACCTCATGGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 805 1452 12 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12144549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13845723
GRCz11 21 13942452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGATATTTCAATATCTCTTTCTCATGGTCTTCTCACCTTCAGCTA[T/A]CAGAGTGTTAAAGAGCTCCCCGGGACACTGGATCAGGCTGTGACTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1030 1452 15 23
ENSDART00000140413 Nonsense 209 253 4 4
Genomic Location (Zv9):
Chromosome 21 (position 12137985)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13839159
GRCz11 21 13935888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACACCACAAAAAAGCACATTGRTACATCAGGAAAATGCACAGGTCCKTA[T/G]AAGAAAATAGGAGGGGAGGAAAGGTGTTCTTTTTCCAGTCTTTCTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1105 1452 16 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12135946)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13837120
GRCz11 21 13933849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAATCAGCAACTCCGCTCTCACAGAAGCCCCTCCCTCCACAGGCCTTA[T/A]CACCACAGTTCTGCTCAGCTAACAAATCACCAGTGAGTTTCCTAAAGGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29544
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1252 1452 19 23
ENSDART00000140413 None None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12131280)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13832454
GRCz11 21 13929183
KASP Assay ID:
2261-5373.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAGTGTCGCCTGTGAAATCAAGAGGAAGAAGACAAACCAGGAGATTT[G/T]AATGTCACAAAGAGGATAGTACATGTAAGAAAATATTTAATACAATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 1325 1452 21 23
ENSDART00000140413 None None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12129240)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13830414
GRCz11 21 13927143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCCATTGTGTGGTGCATTACAAGCCATTCAAAGAGCCTCTAAGCCAG[G/A]TTTGGTGCTTCATTATCTATATATGAAATGCTTTCATTAAACTTTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1408 1452 23 23
ENSDART00000140413 None None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12126258)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13827432
GRCz11 21 13924161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCATCAAATCCCGTCAGGCCTGAGAGGTCAGGGGTCAGAGGTCACCGC[A/T]GACGCTCTTCCTCCATGGAGTATCATCAGGATTCTATGAGCAGCGCTTTG
Associated Phenotype:
Not determined