Busch Lab

ZMP

si:ch73-222h13.1

Ensembl ID:
ENSDARG00000087107
ZFIN ID:
ZDB-GENE-090313-144
Human Orthologue:
AC013275.1
Human Description:
Primary ciliary dyskinesia protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q4G0U5]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32605 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25534
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111387 None None 282 None 8
ENSDART00000128335 Nonsense 45 329 2 9
ENSDART00000139749 Nonsense 122 829 5 24
Genomic Location (Zv9):
Chromosome 1 (position 9979982)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10119768
GRCz11 1 10803879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTGCCGACTAGTCCCGGGTCTTGCTTACACTGTTACAGTGTTTTTT[C/T]GACCAGACGAGTGGCGTTACTTTTCTGATAACATTAGGATTCATGGCAAG
Long Flanking Sequence:
TGTTGTACTGAAGCAGCTAATATTCATTTACAATGATGAAGGTCAGAGGGTTGCTGAAGAACTAATGAGAGATTTCGGCTTCTCTCTGGGCTTTCACTGCCTTTCTACAACTCACTTTTATCATGTGTTCAATACTTTTTTCCTGTGTCATTTGATTTTTTTTTTACACATAACTTAATTTGTACACTAATTAGTTTTATTTTCTTTGCATATATGAATTGTTTTGGTTGTTACCAACATCTGGGGAAAATTTCAAATCAACAGCACCTTTAAAAATATGTTTTCTGAGACAAATGGTGACATGTTCAATACTTTTCCCCCACTCTTTCTATATTTCATTATAGATGTGTTAAGTATTTTTTTATTCAATAAGATCTTGCATGAACAAAAATAAGGCTTGTCTAAAGAACATTAAGATTGTAAAATTGATTGCTTTTTCCTTATTTTAAATGCAGTGCCGACTAGTCCCGGGTCTTGCTTACACTGTTACAGTGTTTTTT[C/T]GACCAGACGAGTGGCGTTACTTTTCTGATAACATTAGGATTCATGGCAAGGTAAAAACATGGGTTTGGCTGTTGTTTGCAGATGCAAATTCAAAAAGTGGCCAAACAGTGTTGATGTGTCTGTTGTGTTGTTTTAAGGGAGAAGAGAACTTACTGGTTCCCGTTCATGCATATCCTGTTATCAATGACCTTCACATCCCATCTCACATTAGTCTTCCCCCAGTGCCGCTTGGACAGAGGTACAGTTTACAGTAATCATCAAATTACACCAATAACAGGTTATATAACTGGGATTTGTTTCTTTCATGTGATTCACAAAGGAAAAAGTCTAAATATTACCAGGGATGCACCCATGTAGATTTTTTGACCGATACCGATAACCAATAACTCATTAGATTTGGAGGCCGATAACTAGGCCCACACGGAATCTGCGCGCACAGAATTCCGCAGATTTTCAGCAGAATTCCGCAGATTACTGCAGATTTTTAGCCCATTATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32605
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111387 None None 282 None 8
ENSDART00000128335 Nonsense 191 329 6 9
ENSDART00000139749 Nonsense 268 829 9 24
Genomic Location (Zv9):
Chromosome 1 (position 9975860)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10115646
GRCz11 1 10799757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCATTGTTATTTCTCTGTGTCTCAGTAAGCCGGATGGAAATGGTGAC[G/T]AGGAAGAGGATTTTGCTGACGAGCAGAAGACTTATGGAAAATATCCGACC
Long Flanking Sequence:
CTCTTGAACCACATCTGACAGAAGCATCAATAGCTTTCACACACGTCAATTAAAAGAAACGCTGCACATCACAAAACCACTTTTGGGTTGCAACTCATCCAAAAAACGCTGATATACTGTATGTAGCACATGCAATAATTTGTAGCCTCTTTTTTATTTGAGCTCCATCAGACAAAGCATGCAACACCTCAGAACATTCTGTTGAACATTCTTTTTTTTTTTTGCAGAAAAATGACAGTTAATATTTTAACTTGCATAATAAGTTACATAATAAATAATTTTGCCTTTTAGGGCTCATTTTTACCAATTGGACATGCTTAGCTTTTCTAAATTTACTGTAAACCACAGTTGCACAAGACCTACTGCTTGATCACAGCTTAAAAATTAAAATGATGAATAAGTAATGCAAATATTTGAGTTCAAATGCTATTTCAGATAATACTAACATTATTGGCATTGTTATTTCTCTGTGTCTCAGTAAGCCGGATGGAAATGGTGAC[G/T]AGGAAGAGGATTTTGCTGACGAGCAGAAGACTTATGGAAAATATCCGACCCTAACATCCCATCCTAAGCTTAAAATGACTCCCTACTTGGATAAGGTTAGAAAATCTATTATTGTATTTAGTAATTCAAGCATACATTCAATCATCAGCCTACCAACCCGTGTTCTCAAATGATCAGCTTCAACATGCATTTTAACATTGGTTTGGTGGAGGAGCAGACAAACCATGCTGTTGTTCACCAGCGAAAATACTGGATACCCAGTATAGTATTTTCTAACTGTGAAAGTCAGCCATTACCAAAAACAGAAAAGACTTTTTTCAACAGGGTCTGAATGGCTTTGAGCTGTACAGATGCAGGAATGTGAATTAGCTGAGGCTCAATTTCATTTTGGCCCATTAAAAAGCAGTAGCAGAGTGGTTTGTGTGAGATTGAATTACAAATGTAATTTTATTGTTTACACCAAGCTTACGGAATTGAATTTGAATTGACCGCATGCCCTG
Associated Phenotype:
Not determined