Busch Lab

ZMP

NTNG2 (2 of 2)

Ensembl ID:
ENSDARG00000087100
Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Human Orthologue:
NTNG2
Human Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Mouse Orthologue:
Ntng2
Mouse Description:
netrin G2 Gene [Source:MGI Symbol;Acc:MGI:2159341]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9458 Nonsense Available for shipment Available now
sa23847 Nonsense Available for shipment Available now
sa37213 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Nonsense 189 1579 6 10
Genomic Location (Zv9):
Chromosome 21 (position 4169542)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3844542
GRCz11 21 4009161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATATTATTAGTCACCAGTGCATCTGTCACACCAGCACCTGAACCTKTT[G/T]GATCAGTGCSGGAGTCTGCCGAGCCAAAGCCAGAGTCGATTCCRAAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Nonsense 276 1579 6 10
Genomic Location (Zv9):
Chromosome 21 (position 4169804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3844280
GRCz11 21 4008899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGAGACTATACAGAAACCTCATGAACCAAAAGTGAATTCTCATGAAT[C/A]AATGCATAAACCCCATGAGCAAATTGTAAATCTTAATGAATCAATGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37213
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Essential Splice Site 1406 1579 7 10
Genomic Location (Zv9):
Chromosome 21 (position 4173899)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3840185
GRCz11 21 4004804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGAAACAGACTGTACAGCTAAAAGGCATCATATATGACGACTTTCAAG[G/A]TGAGAAAGAATCACAAATGGAATGAGAAAATGAAGATGTTTATTTGATGT
Associated Phenotype:
Not determined