Busch Lab

ZMP

D7R492_DANRE

Ensembl ID:
ENSDARG00000087084
Description:
GPR81-like protein 4 [Source:UniProtKB/TrEMBL;Acc:D7R492]
Human Orthologue:
OXER1
Human Description:
oxoeicosanoid (OXE) receptor 1 [Source:HGNC Symbol;Acc:24884]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35302 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35302
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121736 Nonsense 260 312 1 1
Genomic Location (Zv9):
Chromosome 12 (position 26820969)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25201957
GRCz11 12 25293317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGCAACTTCCTTCAAGTGTTTCCTTGCTCTGAATCCCTCATTGTGTG[T/A]CTCCATGCCTCTTTAGCTTTATCCTACATGAACAGTGCACTGGATCCAGT
Associated Phenotype:
Not determined