Busch Lab

ZMP

ENSDARG00000087075

Ensembl ID:
ENSDARG00000087075

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25282 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25282
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114141 Nonsense 780 912 6 6
Genomic Location (Zv9):
Chromosome 4 (position 41225970)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 39597010
GRCz11 4 40058973
KASP Assay ID:
554-7305.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAGAGAGAATCAGCCGTATCCTGATCATCCAGACAGATTTGATGTGT[G/A]GCCTCAGGTGTTGTGCAGAGAGAGTGTGTGTGGACGCTGTTACTGGGAGA
Associated Phenotype:
Not determined