Busch Lab

ZMP

URB1 (2 of 2)

Ensembl ID:
ENSDARG00000087043
Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10519 Nonsense Available for shipment Available now
sa42481 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 44 1605 1 31
Genomic Location (Zv9):
Chromosome 15 (position 5614266)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5732603
GRCz11 15 5720454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTAGTGGCACTGTTTTTAAATCYATGCTRAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACWGTTSAAAACATMATTTATTA
Long Flanking Sequence:
TATTTAACATAAAAATACGGGGCATTTTTGAGCAGTTTCTTTTCTGTCTACCCTCTGTATAAAATTTTCTGTCATCAATGAATGAATACAATAAAAAAAAATACATTTTAAGATCGTAGTGGATCCTTTAATGATTTGGTTTTGCTCATGAATATGTTACGATGCGTGAGGCGGGCGTAGAGCTGGCGAACCAATACATGTCTTATCTTTTGGATATTAATTAGATTTCGTAACGCTCTAAAGAGAACGTCATGACGTTAAGTTTAATATTAATGAGTTCGTCGTTTCCACGTGTTTTGCTCCTCTGTCGTTTCTAGCTTTACACTTCCGCCGTTCCATGTGTTGGATTTCGTTCACAGGAACACACAGAAATGGCTACTAAACGTGAAAACGAAGAGAATATTACCGAGTCTGTGACAAAAGCAAAGAAAGGCAAAACAGACGAAAGCGAGTTTAGTGGCACTGTTTTTAAATCCATGCTGAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACTGTTCAAAACATAATTTATTAATTTGTACAGTTTGAGTTCAAAACGCACGATTCGTGTACACCATTAACGTTAACGTTACATAGTAATTGCCTCTAGCTGGTAAATAAAACCTCTCTGCTAGCCTAGTGCTTTAGCCAAGATCTCCTCAGACCTTTATTTTGTTTTCCCAACATGCATTATTATTATTTTATTATTCAAAGTAAAGTAATCATTTTGTACTATATATTTATACAATATAAAATTAGTACTTTCCTTTAAATAATACAAGTAGGATTCACAGAAGTTGCCAATCGATAATTTGAAAACAAATGTGGATGCAATTTTTTGGACACAATTGTTAAGTTTGCAATACTAAAATACAAATTTAAAATAATTATGGTTTAACCTCTTAAGACCTTAAAAACATTACAAAACGCAAAAAACCTTGTTAAATGTCTACTTTTTTGACATGAACATTTTAAAGTGTGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7752
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 535 1605 13 31
Genomic Location (Zv9):
Chromosome 15 (position 5595111)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5713448
GRCz11 15 5701299
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTTGATRTTAAAATACTAAANATCTATTGTGCTTTTTCTCTTAAAGCA[C/T]AACAGGATGATCCACACCTCATCCTGGTCAAAGCTCTGCTTCTTCAAGTC
Long Flanking Sequence:
AGAGATGGGTTGCAGCTGGAAGGGCATCCGCTGCGTAAAAACTTGCTGGATAAGTTGGAGGTTCATTCCGCTGTGGCGACCCTGGATTAATAAAGGGACTAAGCCGACAAGAAAATGAACGAATGAATGAATGTTAGACATTTTTACAGAAAAATCCTCAAATTGAATCCAAATTGAAGCAATTCACAATTTCTCATGGTAATTCCAGGCCATTAGAAATAATTATTTGTGTTAACCCTGTATAAGGCTAAAATGTAATTCTTTATGGTGCAGAAGGGTCTTAAAGTCTATAATGTGACTTGATTAAACCTGCAGAATCCCTGTGAAAGTATCTTCTTTTGTGTTCAACAGAAAAAAGAATCTCATAGAGGTTTGGAACTTGTGAAGCGTGAACTTGTGAAGCGTGATTTTTAGTTGAACCATCCATTTAAATAATTTCATAACCATCCTTTTGTTGATGTTAAAATACTAAAATCTATTGTGCTTTTTCTCTTAAAGCA[C/T]AACAGGATGATCCACACCTCATCCTGGTCAAAGCTCTGCTTCTTCAAGTCATGTGTTTATATCAGAAAGTGGTTCCTCACCTTGTCACCCAGAGCAGATTCGACTTCAGCAAACTTCTGAAAGGTAGAACAAGCATTAAGACTGAAAACCGATTCAGCAAATTACCTTCTGACCTGGGCAAGGCTAAGCGAATCACTGAAATATTTGCAGGTATTGTGACGGAGAGTGGGATGACACAGGAAGTTCCTCCAGTTTTGCAGTACCAGATTCTACAACTGGCTCTTGAACTTCCTGCAAGCAAATTCTCCTGGTTTCGTGTTCAGGTAAAAACCTTTTCCTTTTTTGAGTCGTGTGTTTGTTTTTCAGATTGACGTAAGCACATCTGTATTTTGCTAATTACCAACAATAGCCGCGTTTCCACTATCGCGCCTAAAGCGAGCGAGCCAGGGCGAGCCAAGGCCAGTGGCGTTTCCACTGTCACTTCCGGGGCCTAATCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42481
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Essential Splice Site 692 1605 16 31
Genomic Location (Zv9):
Chromosome 15 (position 5590144)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5708262
GRCz11 15 5696113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGTTGGGTCTGTCCCAGCAGGAGACCGTCATACAGTTTCTAGACCATG[T/C]ACTGGATTTTGACCACTTGCATATGGTTTTACTGGGCATTTGTCATTTTA
Long Flanking Sequence:
CAGAGAGGAGTCACATCCATAATGAAGCTTTTCCCTCCATAAATGCAAACATGTTAAATAAAATAAAATCAATAATTTTTGTTCTGTAGAGAGCCAACTCTCATCCTTTTGATTGGCATTATTTATTATGGATTGTGCGACGAAGCATGTTGTGGACTGCAAGCTCGCTAGCTTTTTTGGTTACATCCATAACGCATGTTTATTTTGCTCATTTAATATTTACAGATTGATATTTTTTTCTGATTTCATAACTCTGTGGTTAGTTGTTTTGGAAAATATAAACAGATGTTTCAATATAATATAATATATAATATATACCAGCACATTTACTTTGAAAACAAAACAAATCCTGTGATGTGATATCTTGACCTCTGCTTTTCAGGTGTTGAGGGACAGTGGTGTATTTGAGCACACGTGGAAGGAGCTGGCGTTATGGCTGGATCATCTGACGACGTTGGGTCTGTCCCAGCAGGAGACCGTCATACAGTTTCTAGACCATG[T/C]ACTGGATTTTGACCACTTGCATATGGTTTTACTGGGCATTTGTCATTTTAGTCTGTCCAACAACATTCCTTACTGACAGTTTTTCAGCAAGGAGAATATTTAGGAAGAACTTGTTTATTCTAATAGGAAATTTTATACATTTTCAAGTGTAAAATGTTTAAAATGGCATTTACAAAAACTTTTTTAAAAGGGGGAAAGAGTAAAAAAAAATTAAGCCAAGACCCTATAGGCAAACCATTTAGTTTTTTTACATTTTAGGCTAATTTGTGTTTGCTAATTTGCTGTTTTTTCCCCAAATGAACAGATCTGAATAGATTCCATCACATGATATAATTTCAGAATTGCATGTTTTAATCCTGTGGTGGAAACAAAGTTCCAAAATTCTGGCAACCACAGCTGCAATTTTTATTGTAAATAATTTAATGATTAACAAAATTATCAATCATAAGGTTTTAGAAAACATTTGAAAATCTTGTTTGTCTGCTGTGTTTTGATTGCAA
Associated Phenotype:
Not determined