Busch Lab

ZMP

si:ch211-200e2.1

Ensembl ID:
ENSDARG00000087032
ZFIN ID:
ZDB-GENE-030131-3078
Human Orthologue:
C20orf151
Human Description:
chromosome 20 open reading frame 151 [Source:HGNC Symbol;Acc:16144]
Mouse Orthologue:
BC066135
Mouse Description:
cDNA sequence BC066135 Gene [Source:MGI Symbol;Acc:MGI:3606212]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31082 Nonsense Mutation detected in F1 DNA Not yet available
sa43914 Nonsense Mutation detected in F1 DNA Not yet available
sa19315 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29875
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Essential Splice Site 37 579 3 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 Essential Splice Site 37 240 4 10
ENSDART00000138074 None None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7558328)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7550791
GRCz11 23 7484763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAAGTAAAATTCCCATGATGTCCGATTATAATATTTTGTTGTGCTGT[A/G]GTGACACGAAGCGCTTAGAAGAACTTCACAGCAGGAATCAGCAGCTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31082
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074 None None 185 None 2
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074 None None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7562094)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7554557
GRCz11 23 7488529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAAGGTGTCTCCTGATCCAGCTGTGTCCTCAGGGCTGAAGTCCTG[T/A]CAGCCTCCAGCAGGGGACGCCACTGTACCGGCAGCAACCGTCAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43914
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074 None None 185 None 2
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074 None None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7562094)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7554557
GRCz11 23 7488529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAAGGTGTCTCCTGATCCAGCTGTGTCCTCAGGGCTGAAGTCCTG[T/A]CAGCCTCCAGCAGGGGACGCCACTGTACCGGCAGCAACCGTCAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Essential Splice Site 509 579 10 14
ENSDART00000135551 None None 41 None 3
ENSDART00000137240 None None 240 None 10
ENSDART00000138074 None None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7572888)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7565351
GRCz11 23 7499323
KASP Assay ID:
554-6182.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGAGAACAAGAAAGTTCCTTCACTAACTATTTCCCTCCAACCAGG[T/C]AAAGCTGTATTTTTCATTAAGCATAAATGCAACAGTATTAACCAGGTCTA
Associated Phenotype:
Not determined