Busch Lab

ZMP

ENSDARG00000087019

Ensembl ID:
ENSDARG00000087019
Human Orthologues:
CGN, CGNL1
Human Descriptions:
cingulin [Source:HGNC Symbol;Acc:17429]
cingulin-like 1 [Source:HGNC Symbol;Acc:25931]
Mouse Orthologues:
Cgn, Cgnl1
Mouse Descriptions:
cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]
cingulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915428]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39487 Nonsense Mutation detected in F1 DNA Not yet available
sa30277 Nonsense Mutation detected in F1 DNA Not yet available
sa8721 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15716 Nonsense Available for shipment Available now
sa11668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39487
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 73 507 3 14
Genomic Location (Zv9):
Chromosome 25 (position 29822598)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28512692
GRCz11 25 28955894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTGCCTCTAAAGTACATGTATTTTTAAATATTTTGGGTCTTCAGTTG[A/T]AAGAAAAGCTGTCGTCTAACCTAACCAAGGCCACAGAGAGACTACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30277
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 229 507 4 14
Genomic Location (Zv9):
Chromosome 25 (position 29823146)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28513240
GRCz11 25 28956442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATGTGGCGATGACGTTATGCTCAACTCAGGAAGAACTAGATGTGCTC[A/T]AAAGTCAACAGCAAGAGAAAGACGGAGTATGTTTTTGATTTAATCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8721
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Essential Splice Site 272 507 6 14
Genomic Location (Zv9):
Chromosome 25 (position 29823865)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28513959
GRCz11 25 28957161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTKAAATYCTGAAGAAGGAYGGACATCAGATTTTTTYCCCCATGTTTTTC[A/T]GGAGTCACAACAGAGTRATAAAGTCCAGAARCTGGAGAAGCTGCTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 293 507 6 14
Genomic Location (Zv9):
Chromosome 25 (position 29823931)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28514025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TRATAAAGTCCAGAARCTGGAGAAGCTGCTCTCAARGAAGGAAAAGGAAT[T/A]GATGGAAAAGTATGTACAKCTATCTATCTATCTAWCTATCTATCTATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 432 507 12 14
Genomic Location (Zv9):
Chromosome 25 (position 29839118)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28529212
GRCz11 25 28972414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGTGAAAYGTGTTCTATTCAGATCTTCAGTGTTCCCAAGAAGACCTTA[C/A]TTGGCTGATAATTTGGTCCAAAATGCTTCAGATATTAAGGTAAACAWGCA
Associated Phenotype:
Not determined