Busch Lab

ZMP

si:ch211-204d18.1

Ensembl ID:
ENSDARG00000086990
ZFIN ID:
ZDB-GENE-070912-183
Human Orthologue:
LRRC16B
Human Description:
leucine rich repeat containing 16B [Source:HGNC Symbol;Acc:20272]
Mouse Orthologue:
Lrrc16b
Mouse Description:
leucine rich repeat containing 16B Gene [Source:MGI Symbol;Acc:MGI:2448573]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13993 Essential Splice Site Available for shipment Available now
sa19830 Essential Splice Site Available for shipment Available now
sa32986 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6857 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25874
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Nonsense 24 1384 2 40
ENSDART00000141850 None None 152 None 5
ENSDART00000147939 None None 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38452842)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38783260
GRCz11 2 38748899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTCTGGCCGTTAATGCATCGCCTTTCTATTTTGCAGAGAGCATCAGA[C/T]GAGTTATTGACAAGACATCAATCAAGTTAGTGAGAGCTATCAAAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13993
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 661 1384 None 40
ENSDART00000141850 None None 152 None 5
ENSDART00000147939 Essential Splice Site 337 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38551574)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38881739
GRCz11 2 38847378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WCAGGCGTACCGCAGCTCCCCYGACAGGACAGAACAGGCACTGACCAAGG[T/A]GAGAATATTGCTTTTGAAAAAGGGGGMTAGGARGATTTATTCAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19830
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 831 1384 27 40
ENSDART00000141850 None None 152 None 5
ENSDART00000147939 Essential Splice Site 507 536 15 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38565601)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38895766
GRCz11 2 38861405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCACCGCTCTGATGGAGAGAGCGGCGCAAGACATCAACAGAGCTCTGGA[G/T]TAAGAAACACTATAGGGCAGGGGTTCCTGGAGATCTACCTTCCTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 897 1384 29 40
ENSDART00000141850 None None 152 None 5
ENSDART00000147939 None None 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38567114)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38897279
GRCz11 2 38862918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACGCAGACATGCTGGACGTAGTGGAGGACGACTTCGGCATCAGCATAG[T/A]AAGTGTGTTACATGAATCACTCGTGTGTTTACAGTATCTGTCATCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 1311 1384 37 40
ENSDART00000141850 Essential Splice Site 79 152 2 5
ENSDART00000147939 None None 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38585679)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38915844
GRCz11 2 38881483
KASP Assay ID:
554-5166.1 (used for ordering genotyping assays)
KASP Sequence:
GCTAAGCCTGTGTTTCATTCCACTTCAGTAGATTCTGCTTTACTTCAAGG[T/A]AATTCAGGGACAACATTGATGTTTAAATGTCATACTGGATGAGGCRATTA
Associated Phenotype:
Not determined