Busch Lab

ZMP

LOC568576

Ensembl ID:
ENSDARG00000086947
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24622 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125754 Nonsense 28 495 1 5
Genomic Location (Zv9):
Chromosome 25 (position 12762268)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13092191
GRCz11 25 13188696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATAGCCCCTGGAAAAGTCATATTTGCATAACTAAAATTGCGACATCT[C/T]AGTGTTTATGTGGAGATTTAAAGCTGATCACTAGTCTTTCAACGCATTTG
Associated Phenotype:
Not determined