Busch Lab

ZMP

TCF24

Ensembl ID:
ENSDARG00000086944
Description:
transcription factor 24 [Source:HGNC Symbol;Acc:32275]
Human Orthologue:
TCF24
Human Description:
transcription factor 24 [Source:HGNC Symbol;Acc:32275]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24501 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24501
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130162 Nonsense 72 176 1 2
Genomic Location (Zv9):
Chromosome 24 (position 24350851)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23597729
GRCz11 24 23742903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGGAGACCCGCGGCAGCCAATGCGGCGCGGGAGAGGAGTCGCGTA[C/T]AGACGCTCAGACACGCGTTCCTCGAGCTACAGAGAACACTACCGTCGGTG
Associated Phenotype:
Not determined