Busch Lab

ZMP

ENSDARG00000086857

Ensembl ID:
ENSDARG00000086857
Human Orthologue:
AC118759.1
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NP22]
Mouse Orthologue:
Prol1
Mouse Description:
proline rich, lacrimal 1 Gene [Source:MGI Symbol;Acc:MGI:107496]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa30261 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30261
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127416 Essential Splice Site 92 179 5 10
Genomic Location (Zv9):
Chromosome 25 (position 23936381)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23115494
GRCz11 25 23213042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAACAACAGCTTCTACATCAACTGTGTTACCAACATCATTTCCTTCAA[G/A]TGAGTATTTTAATTCATAAACAATTTTGTAAACATTTAAATTGGAAAATG
Associated Phenotype:
Not determined