Busch Lab

ZMP

ENSDARG00000086841

Ensembl ID:
ENSDARG00000086841
Human Orthologues:
GPR132, GPR4, GPR65, GPR68
Human Descriptions:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
G protein-coupled receptor 4 [Source:HGNC Symbol;Acc:4497]
G protein-coupled receptor 65 [Source:HGNC Symbol;Acc:4517]
G protein-coupled receptor 68 [Source:HGNC Symbol;Acc:4519]
Mouse Orthologues:
Gpr132, Gpr4, Gpr65, Gpr68
Mouse Descriptions:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]
G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]
G protein-coupled receptor 68 Gene [Source:MGI Symbol;Acc:MGI:2441763]
G-protein coupled receptor 65 Gene [Source:MGI Symbol;Acc:MGI:108031]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36332 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36332
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122205 Nonsense 54 272 2 2
Genomic Location (Zv9):
Chromosome 17 (position 10012254)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10433070
GRCz11 17 10589104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATTGGGTCCATAGGTGTCCTGAACATGGCCCTGTGTGATCTTGCCTA[T/A]CTGGCCTCTGTAGGACCCTGGGCTGCCTACATTTGCTCGGACTACCACTG
Associated Phenotype:
Not determined