Busch Lab

ZMP

si:dkey-27b3.7

Ensembl ID:
ENSDARG00000086838
ZFIN ID:
ZDB-GENE-091204-176
Human Orthologue:
ITGA2
Human Description:
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) [Source:HGNC Symbol;Acc:6137]
Mouse Orthologue:
Itga2
Mouse Description:
integrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:96600]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38778 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8378 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21668 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3777
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Nonsense 12 674 1 18
ENSDART00000141045 None None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8951560)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9027516
GRCz11 10 8861075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGGTCGGAGCTCCRATGTACATGAGCGAGGAGAAAGCTGAAACCGGA[C/T]GAGTCTACATGTWCACCATTACCAAGGTGAGACAGMTTTACTGTCTGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27562
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Nonsense 87 674 2 18
ENSDART00000141045 None None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8951870)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9027826
GRCz11 10 8861385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCATTTACATCTACTATGGAGACAGAAAAAGCATCAGAACGCAGAGCT[C/A]ACAGGTAGAATGCAGTCATTTTAATTTCCCTGATTAAATGACCATTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38778
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 132 674 3 18
ENSDART00000141045 None None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8953250)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9029206
GRCz11 10 8862765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATCCCTGATATTTCAGTCGGAGGTGAAGGGAAGGTAGTGCAGCTCTG[G/A]TGAGAGTCTTGTGTTGCTATTTAACTGGATATACTTCCTTACTTACTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 186 674 None 18
ENSDART00000141045 None None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8954756)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9030712
GRCz11 10 8864271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGTTTGYTTCAGGTCCACATTTAGACCCWMAGGTTTGGKTAAAGTAGG[T/A]AAGCCTATCWCTRGTGAGTTTTATATCTCCCGTATGTTCAAAAATCCCMG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 464 674 None 18
ENSDART00000141045 Essential Splice Site 66 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8968041)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9043997
GRCz11 10 8877556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATCAAATTTTGATGACATCGGCCGAGAGTTCAACATAACGTTAAGAG[T/A]GAGTCCAAAAATGTATATTTATTATTTCTATACATGAACATGTCTGAAGT
Associated Phenotype:
Not determined