Busch Lab

ZMP

ENSDARG00000086831

Ensembl ID:
ENSDARG00000086831
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa19946 Nonsense Available for shipment Available now
sa39986 Nonsense Mutation detected in F1 DNA Not yet available
sa39987 Nonsense Mutation detected in F1 DNA Not yet available
sa25991 Nonsense Mutation detected in F1 DNA Not yet available
sa33089 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19946
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 226 862 1 4
Genomic Location (Zv9):
Chromosome 3 (position 7582671)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7121815
GRCz11 3 7007655
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAACCATTCAGATGCACTCAGTGTGGGAAGAGTTTCGGTCGATCATCA[C/T]AGCATGATATACACATGAAGAGCCACACTGGTGTGAGAGAGTATGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 259 862 1 4
Genomic Location (Zv9):
Chromosome 3 (position 7582770)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7121914
GRCz11 3 7007754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTGAGTGTGAGAAAACCTTTATTACATCTGGAGAGTTGAAACTGCAC[C/T]AGAGGAATCACGCTGGGGAGAAACCGTACAAGTGTTCACACTGCGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39987
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 311 862 1 4
Genomic Location (Zv9):
Chromosome 3 (position 7582927)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7122071
GRCz11 3 7007911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGTACATGTGTTCACACTGCAACAAGAGATTCAGTCAGTTACCACATT[T/A]GAAAACACATGAGAGGATTCACACTGGAGAGAAACCGTACAGATGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 520 862 2 4
Genomic Location (Zv9):
Chromosome 3 (position 7602402)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7141546
GRCz11 3 7027386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGAAACCAGAAAATACATGAGAGGATTCACACTGGAGAGAGACCGTA[T/G]AAGTGTTCACACTGCGGCATGAGATTCGGTCAGTTATCAAATCTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33089
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 733 862 4 4
Genomic Location (Zv9):
Chromosome 3 (position 7616145)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7155289
GRCz11 3 7041129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGAAACCATACAAGTGTTCACACTGCGACAAAAGATTCGGTCGGTTAT[C/A]AAATATGAAAATACATGAGAGGATTCACACTGGAGAGAAACCTTATACCT
Associated Phenotype:
Not determined