Busch Lab

ZMP

rab3gap1

Ensembl ID:
ENSDARG00000086726
ZFIN ID:
ZDB-GENE-061027-53
Description:
Rab3 GTPase-activating protein catalytic subunit [Source:UniProtKB/Swiss-Prot;Acc:Q6NUV0]
Human Orthologue:
RAB3GAP1
Human Description:
RAB3 GTPase activating protein subunit 1 (catalytic) [Source:HGNC Symbol;Acc:17063]
Mouse Orthologue:
Rab3gap1
Mouse Description:
RAB3 GTPase activating protein subunit 1 Gene [Source:MGI Symbol;Acc:MGI:2445001]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8357
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128029 Essential Splice Site 6 797 1 22
Genomic Location (Zv9):
Chromosome 9 (position 58048022)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56792234
GRCz11 9 56399680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACCAGGACWGGAATAAACAGAGAGCCAAGATGGCGGCCGACAGTGATG[T/C]GAGTTTCTGTGTAAATGCGYATCTTCATCATCAGTTTCTTCATATKGTGT
Associated Phenotype:
Not determined