Busch Lab

ZMP

ENSDARG00000086705

Ensembl ID:
ENSDARG00000086705
Human Orthologue:
AC135457.1
Mouse Orthologue:
Gm1614
Mouse Description:
predicted gene 1614 Gene [Source:MGI Symbol;Acc:MGI:2686460]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23967 Nonsense Available for shipment Available now
sa11105 Nonsense Available for shipment Available now
sa37339 Nonsense Mutation detected in F1 DNA Not yet available
sa23968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 214 1259 1 1
Genomic Location (Zv9):
Chromosome 21 (position 28830792)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30050036
GRCz11 21 30086731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAACCCGGATTCACTTCAAACACTATTTTGATAACGCCTGACAGAAAT[C/T]AATACAGCAAGGGTCGGGAACAGGAGCATGGTGGCACAGAGCCAAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11105
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 597 1259 1 1
Genomic Location (Zv9):
Chromosome 21 (position 28831943)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30051187
GRCz11 21 30087882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATTTGCWTCAACCAAAGTGAACATCWGAACTGCTACAACTGATGAATG[T/A]TTGTATGTGTCTGGYAAGGATGTATATGCTGAAACTACAAAAACATATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37339
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 698 1259 1 1
Genomic Location (Zv9):
Chromosome 21 (position 28832246)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30051490
GRCz11 21 30088185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGCATTGCAGCTCCCTAACCTGAGCCCTGGAGTGAAGCTATCCTG[T/A]GACTCAGCAAAGGGCAGAACATGGAACTCGAGTGCAGCAACAAATGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 1058 1259 1 1
Genomic Location (Zv9):
Chromosome 21 (position 28833326)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30052570
GRCz11 21 30089265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTTGTGTCCTAACAGTAGCTTCAACTCCTATGGTTCCTTCCTATTA[T/G]TACAAACCCAATGTACTGGGTTACCAAACAGTCTCTCCTCATATTGGTGC
Associated Phenotype:
Not determined