Busch Lab

ZMP

ENSDARG00000086664

Ensembl ID:
ENSDARG00000086664

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa30451 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091103 Nonsense 13 131 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA221 (position 4123)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149893.1 4123
GRCz11 KN149893.1 4123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGGAAGGAAAGATGGACGAGTCGTCGCTGCTGGATCTGCTGGAGTGCT[C/A]GGTGTGTCTGGAGCGGCTGGACACGAGCGCTAAAGTGCTGCCCTGTCAGC
Associated Phenotype:
Not determined