Busch Lab

ZMP

CHRNG

Ensembl ID:
ENSDARG00000086647
Description:
cholinergic receptor, nicotinic, gamma [Source:HGNC Symbol;Acc:1967]
Human Orthologue:
CHRNG
Human Description:
cholinergic receptor, nicotinic, gamma [Source:HGNC Symbol;Acc:1967]
Mouse Orthologue:
Chrng
Mouse Description:
cholinergic receptor, nicotinic, gamma polypeptide Gene [Source:MGI Symbol;Acc:MGI:87895]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25902 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123966 Nonsense 167 540 5 12
Genomic Location (Zv9):
Chromosome 2 (position 45147184)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45232685
GRCz11 2 45085683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACCGAAGCTCCTGTGCCATCAAAGTCAACTATTTTCCCTTTGATTGG[C/T]AGAATTGCAGCATGGTGTTCAGGTACAACGGATCCGTCTATCCTGACAGT
Associated Phenotype:
Not determined