Busch Lab

ZMP

zgc:136963

Ensembl ID:
ENSDARG00000086603
ZFIN ID:
ZDB-GENE-060312-8
Description:
hypothetical protein LOC664694 [Source:RefSeq peptide;Acc:NP_001034923]
Human Orthologue:
FUT9
Human Description:
fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
Mouse Orthologue:
Fut9
Mouse Description:
fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34280 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2480
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123553 Nonsense 147 355 2 3
Genomic Location (Zv9):
Chromosome 8 (position 3477372)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3321889
GRCz11 8 3380638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCAAAAATACCCGGTCTGGAGAACCTCTTCAATCTCACYCTCAGCTAC[A/T]GACATGATTCTGATATTCTTGTACGGTTGCGTTTGAGAACCAGGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123553 Nonsense 243 355 2 3
Genomic Location (Zv9):
Chromosome 8 (position 3477662)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAGCTGCAAATTTTACCTCTCTTTCGAGAACTCCATTCACGAGGACTA[T/G]TTTACAGAGAAGATCGAATTCCCTGAATGAAAGAGCCAAACTGCAGTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7115
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123553 Nonsense 305 355 3 3
Genomic Location (Zv9):
Chromosome 8 (position 3579720)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3322363
GRCz11 8 3381112
KASP Assay ID:
554-4471.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTGGCAGAATATCTGCTTCAGCTGGATAAAGATGACGTTGCCTATCGC[A/T]GATACTTTGATTGGAGGAAACATCTYGTGGCAACTCCTCATTTAATACAG
Associated Phenotype:
Not determined