Busch Lab

ZMP

ENSDARG00000086566

Ensembl ID:
ENSDARG00000086566
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18623 Essential Splice Site Available for shipment Available now
sa3168 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa18623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124937 Essential Splice Site 78 210 3 6
Genomic Location (Zv9):
Chromosome 22 (position 22853815)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22465451
GRCz11 22 22490429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRTCTCTCTGTGCACTGCTGGTGACCTTGATGCTGTTTACYGTGTTGGAG[T/C]AAGTGCTTTTYACCCATAYACCGCATCATTCACCGTCTTTATCATGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3168
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124937 Nonsense 181 210 6 6
Genomic Location (Zv9):
Chromosome 22 (position 22861111)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22472747
GRCz11 22 22497725
KASP Assay ID:
554-2798.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCCAGTGCTGATCGTCACCATCACACTGGCCTCWGCCTCTGGGAAATA[C/A]ACTGCTGAYGGTCACTGCTGGCTCAGTGTTCAGAAYGGCGTCATATGGGG
Associated Phenotype:
Not determined