Busch Lab

ZMP

LOC100332507

Ensembl ID:
ENSDARG00000086540
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa28538 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4627
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124723 Essential Splice Site 245 678 8 13
Genomic Location (Zv9):
Chromosome 15 (position 42634716)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43988013
GRCz11 15 44011456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGCTGGAGAATGAACTGGCCAATCAGATCAGCATCATCTCWGAGAAAG[G/A]TGTGATATTTACTGCMYTGGAGCGAGTGAATTAGGACATTTGCAGTGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28537
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124723 Essential Splice Site 407 678 12 13
Genomic Location (Zv9):
Chromosome 15 (position 42636536)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43986213
GRCz11 15 44009656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAGCTCAGTCTCAGGAGAGAGGAGAGGTGCTGGGGCCCATCATGGAG[G/A]TGAGATGGAGTACTTTATTTATTTAGTTTAGTTTTTGTGTGTGTAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28538
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124723 Nonsense 496 678 13 13
Genomic Location (Zv9):
Chromosome 15 (position 42636972)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43985777
GRCz11 15 44009220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTTGTGCTGCTTCTGCTGCATCAGAAAAACAAGAGCAAATGCTGGTTT[T/A]ATCAGCAGAGGTAACATCTCTGAAAGAGCAGATCTGCAGATATAGTGAAA
Associated Phenotype:
Not determined