Busch Lab

ZMP

si:dkey-90l23.2

Ensembl ID:
ENSDARG00000086529
ZFIN ID:
ZDB-GENE-041008-200
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9699 Essential Splice Site Available for shipment Available now
sa21435 Essential Splice Site Available for shipment Available now
sa21436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105123 Essential Splice Site 116 312 6 12
ENSDART00000136847 Essential Splice Site 114 208 6 9
ENSDART00000138713 Essential Splice Site 115 209 6 9
Genomic Location (Zv9):
Chromosome 9 (position 8408964)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8388807
GRCz11 9 8367137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCYAGTTCTTTTTCCTTTGTKCAAACTTGTAACCTTCCTCAATGTCTTTC[A/T]GAAACGAGTGTWACTTGTGAAGGCAAAAATAGTGAATTGAAGTGTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21435
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105123 Essential Splice Site 130 312 6 12
ENSDART00000136847 Essential Splice Site 128 208 6 9
ENSDART00000138713 Essential Splice Site 129 209 6 9
Genomic Location (Zv9):
Chromosome 9 (position 8409011)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8388854
GRCz11 9 8367184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAAACGAGTGTAACTTGTGAAGGCAAAAATAGTGAATTGAAGTGTG[G/A]TGAGCTGTATTTTCAATCCTCATTGCATCAATATCGGGTCATGTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21436
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105123 Nonsense 175 312 7 12
ENSDART00000136847 Nonsense 173 208 7 9
ENSDART00000138713 Nonsense 174 209 7 9
Genomic Location (Zv9):
Chromosome 9 (position 8409221)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8389064
GRCz11 9 8367394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGCATAAATACAAAATGCTTTGCACCGAACTCACTGGATCTTGTGCAA[C/T]AAAGGTATTAAGCAAATGGCTGCTTATTTTGCGTTCATATTATTTTGCAT
Associated Phenotype:
Not determined