Busch Lab

ZMP

RELN (2 of 4)

Ensembl ID:
ENSDARG00000086526
Description:
reelin [Source:HGNC Symbol;Acc:9957]
Human Orthologue:
RELN
Human Description:
reelin [Source:HGNC Symbol;Acc:9957]
Mouse Orthologue:
Reln
Mouse Description:
reelin Gene [Source:MGI Symbol;Acc:MGI:103022]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa7450 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7450
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122235 Missense 9 160 1 3
Genomic Location (Zv9):
Chromosome 18 (position 49821974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50887786
GRCz11 18 50787183
KASP Assay ID:
554-4237.1 (used for ordering genotyping assays)
KASP Sequence:
CATCCGCTATGTGGAGACGCAGTCCATGCAGATCGGAGCCTCCTACATGA[T/A]CCAGTTCCAGCTGGTGATGGGCTGCGGGCGCGAGCCGTCRCCACACATCG
Associated Phenotype:
Not determined