Busch Lab

ZMP

rad21

Ensembl ID:
ENSDARG00000086515
ZFIN ID:
ZDB-GENE-030131-994
Description:
RAD21 homolog [Source:RefSeq peptide;Acc:NP_955889]
Human Orthologue:
RAD21
Human Description:
RAD21 homolog (S. pombe) [Source:HGNC Symbol;Acc:9811]
Mouse Orthologue:
Rad21
Mouse Description:
RAD21 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:108016]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25032 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25032
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122963 Nonsense 498 643 11 13
ENSDART00000141248 Nonsense 498 643 12 14

The following transcripts of ENSDARG00000086515 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 51613490)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48474002
GRCz11 16 48416020
KASP Assay ID:
554-7439.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAGCCTAACCATGCACGATTGTGATTCCAGCCAATGGGAGTGTTGGAG[C/T]AGACGCTTCAGCCCTTGGATCAGTCTGTGCTTTCCCATCAGCTCGAGATG
Associated Phenotype:
Not determined