Busch Lab

ZMP

NAALADL2

Ensembl ID:
ENSDARG00000086489
Description:
N-acetylated alpha-linked acidic dipeptidase-like 2 [Source:HGNC Symbol;Acc:23219]
Human Orthologue:
NAALADL2
Human Description:
N-acetylated alpha-linked acidic dipeptidase-like 2 [Source:HGNC Symbol;Acc:23219]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8489 Nonsense Mutation detected in F1 DNA Not yet available
sa13956 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8489
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124127 Nonsense 433 783 8 14
Genomic Location (Zv9):
Chromosome 11 (position 9239735)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 9141646
GRCz11 11 9148732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTTGTTTGTGTKAAAGTAAGTGTCCCCGCTCTGTTTCCCCTTGTAGAT[C/T]GATATGTCCTGGTTGGCAGTCGTCATGGCAGCTGGTATGAGGGTGCGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6191
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124127 Essential Splice Site 500 783 8 14
Genomic Location (Zv9):
Chromosome 11 (position 9239530)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 9141441
GRCz11 11 9148527
KASP Assay ID:
554-4938.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGGGGGGGACYTCTTTGGGCAATATTGGCTCCTATGAGTGGGGAAAGG[T/G]AATATTTGACTATTCCAGCTCAMGCTCATTGTAAAAAARCATGCCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13956
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124127 Essential Splice Site 592 783 10 14
Genomic Location (Zv9):
Chromosome 11 (position 9186131)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 9088042
GRCz11 11 9095128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGTGCCTACGGTGGAGWTCACATACGCAGAGGTCCCTAAAACAGAGG[T/A]ACAATACTTTCACATACNNNNNNNNNNNNAATAATTCAAACATTCTTTAC
Associated Phenotype:
Not determined