Busch Lab

ZMP

ENSDARG00000086485

Ensembl ID:
ENSDARG00000086485

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12552 Nonsense Available for shipment Available now
sa13087 Nonsense Available for shipment Available now
sa12541 Nonsense Available for shipment Available now
sa19074 Nonsense Mutation detected in F1 DNA Not yet available
sa44800 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12552
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2651176)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2356021
GRCz11 14 2274372
KASP Assay ID:
2260-7161.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13087
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2651176)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2356021
GRCz11 14 2274372
KASP Assay ID:
2260-7161.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12541
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2651176)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2356021
GRCz11 14 2274372
KASP Assay ID:
2260-7161.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19074
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2651176)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2356021
GRCz11 14 2274372
KASP Assay ID:
2260-7161.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTTTGATT[T/A]GCAATTGATTGCAGTAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44800
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 730 758 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2652819)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCATCCAGTACAGATCTGGAGACAAACGCTACATGTTAGTTGGACCC[A/T]GAATGAGTATCGGCTCTACTATAGCACCAGGCAGTAATAGGAATACTCTA
Associated Phenotype:
Not determined