Busch Lab

ZMP

zgc:163008

Ensembl ID:
ENSDARG00000086463
ZFIN ID:
ZDB-GENE-030131-2671
Description:
kelch-like 9 [Source:RefSeq peptide;Acc:NP_001092699]
Human Orthologues:
KLHL13, KLHL9
Human Descriptions:
kelch-like 13 (Drosophila) [Source:HGNC Symbol;Acc:22931]
kelch-like 9 (Drosophila) [Source:HGNC Symbol;Acc:18732]
Mouse Orthologues:
Klhl13, Klhl9
Mouse Descriptions:
kelch-like 13 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914705]
kelch-like 9 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2180122]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20481 Nonsense Available for shipment Available now
sa25306 Nonsense Mutation detected in F1 DNA Not yet available
sa12111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 355 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023867)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823551
GRCz11 5 37423704
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGA[C/T]AGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGC
Long Flanking Sequence:
GCGAGTTTGTCAAACTTCCGTTCGAGCGTCTAGCATTTGTTCTCTCCTCTAACAGTCTAAAACACTGCAGCGAATTGGACCTGTTTAAATCAGCGTGCCGCTGGTTACGCTATGAAGAAGGCCGCATGGAATACGCCGCCAAACTAATGCGCAATATTCGATTTCCTCTGATGAGTCCGACGGAACTTATAAACCACGTACAGACTGTCGATTTCATGCGTACGGACAATACTTGTGTTAACCTTTTATTAGAAGCCAGCAACTACCAGATGATGCCATACATGCAGCCGGTGATGCAGTCGGAACGGACTGCGATCCGTTCGGACAATACCCATTTAGTGACGCTAGGGGGTGTGCTACGGCAACAGCTGGTTGTTAGCAAAGAGCTGCGACTTTTTGACGAGAAAGCACATGAATGGAAGGCACTGGCACCCATGGATGCCCCGCGCTACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGA[C/T]AGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTATGACCCCAGGTATAACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCATCTGAGCGCTCTCAAAGGATATCTATACGCTGTGGGCGGGAGGAACGCCGCAGGAGAACTGGGTGAGTCAGGAAGGGATTTTAGTGGCACAGCAGGGAACAGATTTCTAAGAGACATGCTGTGCTTCAATTGCTGACATGTTTTGTAAATATAACATTAAAGGGGAGGTTCACCCAAAATTAAGCCCTCATTTGCTCACCCTGGTGTTGTTTTAACACCACATTGCCTTCTTTTGGTTTTAAAACCACAAAAGGAGAATTTTTTACATTCAATTTTTATTAAAAAAGCTAAAGTATCAAATGTAAATGATCAAACAACTTGCTTTGCAAACAGTTGTGTTTATGGCAATACTAAAATAAATCTAAATAATACAATTAAGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25306
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 372 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823604
GRCz11 5 37423757
KASP Assay ID:
554-7732.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTA[T/A]GACCCCAGGTATAACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAG
Long Flanking Sequence:
AGTCTAAAACACTGCAGCGAATTGGACCTGTTTAAATCAGCGTGCCGCTGGTTACGCTATGAAGAAGGCCGCATGGAATACGCCGCCAAACTAATGCGCAATATTCGATTTCCTCTGATGAGTCCGACGGAACTTATAAACCACGTACAGACTGTCGATTTCATGCGTACGGACAATACTTGTGTTAACCTTTTATTAGAAGCCAGCAACTACCAGATGATGCCATACATGCAGCCGGTGATGCAGTCGGAACGGACTGCGATCCGTTCGGACAATACCCATTTAGTGACGCTAGGGGGTGTGCTACGGCAACAGCTGGTTGTTAGCAAAGAGCTGCGACTTTTTGACGAGAAAGCACATGAATGGAAGGCACTGGCACCCATGGATGCCCCGCGCTACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGACAGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTA[T/A]GACCCCAGGTATAACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCATCTGAGCGCTCTCAAAGGATATCTATACGCTGTGGGCGGGAGGAACGCCGCAGGAGAACTGGGTGAGTCAGGAAGGGATTTTAGTGGCACAGCAGGGAACAGATTTCTAAGAGACATGCTGTGCTTCAATTGCTGACATGTTTTGTAAATATAACATTAAAGGGGAGGTTCACCCAAAATTAAGCCCTCATTTGCTCACCCTGGTGTTGTTTTAACACCACATTGCCTTCTTTTGGTTTTAAAACCACAAAAGGAGAATTTTTTACATTCAATTTTTATTAAAAAAGCTAAAGTATCAAATGTAAATGATCAAACAACTTGCTTTGCAAACAGTTGTGTTTATGGCAATACTAAAATAAATCTAAATAATACAATTAAGAAAATTCTAGTTTGCATCATCTCACACCTTAATAAGCTGTTTTTACCACTGAAAATCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8197
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 376 615 6 8
ENSDART00000128122 Nonsense 376 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023932)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823616
GRCz11 5 37423769
KASP Assay ID:
2259-6203.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTATGACCCCAGGTA[T/G]AACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCA
Long Flanking Sequence:
TGCAGCGAATTGGACCTGTTTAAATCAGCGTGCCGCTGGTTACGCTATGAAGAAGGCCGCATGGAATACGCCGCCAAACTAATGCGCAATATTCGATTTCCTCTGATGAGTCCGACGGAACTTATAAACCACGTACAGACTGTCGATTTCATGCGTACGGACAATACTTGTGTTAACCTTTTATTAGAAGCCAGCAACTACCAGATGATGCCATACATGCAGCCGGTGATGCAGTCGGAACGGACTGCGATCCGTTCGGACAATACCCATTTAGTGACGCTAGGGGGTGTGCTACGGCAACAGCTGGTTGTTAGCAAAGAGCTGCGACTTTTTGACGAGAAAGCACATGAATGGAAGGCACTGGCACCCATGGATGCCCCGCGCTACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGACAGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTATGACCCCAGGTA[T/G]AACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCATCTGAGCGCTCTCAAAGGATATCTATACGCTGTGGGCGGGAGGAACGCCGCAGGAGAACTGGGTGAGTCAGGAAGGGATTTTAGTGGCACAGCAGGGAACAGATTTCTAAGAGACATGCTGTGCTTCAATTGCTGACATGTTTTGTAAATATAACATTAAAGGGGAGGTTCACCCAAAATTAAGCCCTCATTTGCTCACCCTGGTGTTGTTTTAACACCACATTGCCTTCTTTTGGTTTTAAAACCACAAAAGGAGAATTTTTTACATTCAATTTTTATTAAAAAAGCTAAAGTATCAAATGTAAATGATCAAACAACTTGCTTTGCAAACAGTTGTGTTTATGGCAATACTAAAATAAATCTAAATAATACAATTAAGAAAATTCTAGTTTGCATCATCTCACACCTTAATAAGCTGTTTTTACCACTGAAAATCAAGTGCTTGGAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18810
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 376 615 6 8
ENSDART00000128122 Nonsense 376 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023932)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823616
GRCz11 5 37423769
KASP Assay ID:
2259-6203.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTATGACCCCAGGTA[T/G]AACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCA
Long Flanking Sequence:
TGCAGCGAATTGGACCTGTTTAAATCAGCGTGCCGCTGGTTACGCTATGAAGAAGGCCGCATGGAATACGCCGCCAAACTAATGCGCAATATTCGATTTCCTCTGATGAGTCCGACGGAACTTATAAACCACGTACAGACTGTCGATTTCATGCGTACGGACAATACTTGTGTTAACCTTTTATTAGAAGCCAGCAACTACCAGATGATGCCATACATGCAGCCGGTGATGCAGTCGGAACGGACTGCGATCCGTTCGGACAATACCCATTTAGTGACGCTAGGGGGTGTGCTACGGCAACAGCTGGTTGTTAGCAAAGAGCTGCGACTTTTTGACGAGAAAGCACATGAATGGAAGGCACTGGCACCCATGGATGCCCCGCGCTACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGACAGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTATGACCCCAGGTA[T/G]AACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAGGACCTTCTTTCATCTGAGCGCTCTCAAAGGATATCTATACGCTGTGGGCGGGAGGAACGCCGCAGGAGAACTGGGTGAGTCAGGAAGGGATTTTAGTGGCACAGCAGGGAACAGATTTCTAAGAGACATGCTGTGCTTCAATTGCTGACATGTTTTGTAAATATAACATTAAAGGGGAGGTTCACCCAAAATTAAGCCCTCATTTGCTCACCCTGGTGTTGTTTTAACACCACATTGCCTTCTTTTGGTTTTAAAACCACAAAAGGAGAATTTTTTACATTCAATTTTTATTAAAAAAGCTAAAGTATCAAATGTAAATGATCAAACAACTTGCTTTGCAAACAGTTGTGTTTATGGCAATACTAAAATAAATCTAAATAATACAATTAAGAAAATTCTAGTTTGCATCATCTCACACCTTAATAAGCTGTTTTTACCACTGAAAATCAAGTGCTTGGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12111
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 419 615 7 8
Genomic Location (Zv9):
Chromosome 5 (position 39033554)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36833238
GRCz11 5 37433391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGTTTTTTTCTCTTTTCTTGTCTTTCTCCAGCAACGGTAGAGWGTTA[T/G]AACCCCAGAACMAATGAATGGACGTATGTGGCCAAAATGAGCGAGCCGCA
Long Flanking Sequence:
TGCCCTAAACTGAATTGGGTTACGATTTCACCATCTCCAGTCTACTTGAGATAAAGAGCCCTGGATATTAATAATGCATCATCTGCCTATATCAGATCTCCTCTGTGTGATCTGATATGTGCGGACAGATACTTTTATAAAACTTAAGAAAAGCAGGTCTTCTGATTTCCAGAGATTAGATAAGAGAGACGTCTTCTCTGAATATTAAACAAGGTGAAGTAGAGGTGTCTGTGTGCAGGAGCGACTTTATTGCTTCATATCGCGTAAATGCCTCAGTTATATCTAGTAATGGTTTATATCTGTGGACAATAATAAGTGGAGAATATGGTTTTTCGTGTGCGCTAGTAATGCAAAACAAGTGTAGAAATACTCCTATTTAGCTCTTTTACTGTAACCACACAAAATCAACTTTTAGTCTAGCCACTGTCAAGACCGTGTTTTTATCCCTAACTCAGTTTTTTTCTCTTTTCTTGTCTTTCTCCAGCAACGGTAGAGTGTTA[T/G]AACCCCAGAACAAATGAATGGACGTATGTGGCCAAAATGAGCGAGCCGCATTATGGACACGCAGGCACTGTTTACGGAGGATACATGTACATTTCAGGTAACTGTCACACACCTGTGTATTTGCTATCTGTGTTAATTACACTACCATTCAAATGTTTGAAGTCACTAAGATTATTTATGATCAGTCTCTTAAAGGTGCAGTATGTAAGTTGTGGTTAAACTAGGTATTGCACACCTGGTTCAAAACAAACGCAAACAAAGGTTGCCAGATTGACGACACCAACAACAGTGTGCCTAATTCTCGAGCCCTAAAGCTAATTTAAAACATGCTCTAAAGAAAAGCAAAGACATGCGATAGAAGGAATATGTTCCTTATTAAAAGGAGCTGAAGTTTCTATTTTAGAAACGGCTTCCATTTCCTGCAGCTGAACAACAAAATACTGACAATGATTATCTCAGGTACACCTCATGTCCTTTATTTAGTGTTAAATGCTAACAAT
Associated Phenotype:
Not determined