Busch Lab

ZMP

NLRP6 (14 of 83)

Ensembl ID:
ENSDARG00000086422
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25713 Nonsense Mutation detected in F1 DNA Not yet available
sa39728 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25713
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122068 Nonsense 29 881 1 6
Genomic Location (Zv9):
Chromosome 1 (position 59383189)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGAACAAGTATGAGAAAATATTTGAAGGAAACAAACTCAATCAGAAT[G/T]AAACCCTCCTGAACCGCATCTACACCCAGCTGTACATCATAGAGGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39728
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122068 Nonsense 792 881 5 6
Genomic Location (Zv9):
Chromosome 1 (position 59373267)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGGGAGGCGGAATGGAGCGGGAGGGAGGCTGATATAGCTGTTACCTA[C/A]AAGGGAATCAGCAGGAAAGGAAAAAGCAATGAATGTGTTTTTGGCTACAA
Associated Phenotype:
Not determined