Busch Lab

ZMP

ENSDARG00000086410

Ensembl ID:
ENSDARG00000086410

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20307 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20307
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121694 Nonsense 156 433 2 2
Genomic Location (Zv9):
Chromosome 4 (position 43870349)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCACATGAAGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGT[G/T]GAAAGAGTTTTGGAATACAAAGCAGTCTTAAAATTCACATGAGGATCCAC
Associated Phenotype:
Not determined