Busch Lab

ZMP

FMN1 (2 of 3)

Ensembl ID:
ENSDARG00000086384
Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Human Orthologue:
FMN1
Human Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Mouse Orthologue:
Fmn1
Mouse Description:
formin 1 Gene [Source:MGI Symbol;Acc:MGI:101815]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24825 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24825
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130502 Essential Splice Site 149 258 5 8
Genomic Location (Zv9):
Chromosome Zv9_NA233 (position 34321)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34321
GRCz11 17 34321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGATTTGGACTGGAGATTCTGCCTAAATTAAAAGACGTCAAGAGCAGG[G/T]TAACCAAAAGCAAACACACCCAAAGCTGCACTAAATATACGGTTGGAGTC
Associated Phenotype:
Not determined