Busch Lab

ZMP

ENSDARG00000086308

Ensembl ID:
ENSDARG00000086308

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35186 Nonsense Mutation detected in F1 DNA Not yet available
sa27862 Nonsense Mutation detected in F1 DNA Not yet available
sa24901 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35186
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 236 437 1 1
Genomic Location (Zv9):
Chromosome 12 (position 3990156)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3284582
GRCz11 12 3396222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGTACCACTGCTGTATGTTGCTGTATTCTGCTGTATGTTGCTGTA[T/A]TCTGCTGTATTTTGCGGTATCACTGATGTATGTTGCTGTATTCTACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27862
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 396 437 1 1
Genomic Location (Zv9):
Chromosome 12 (position 3990636)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3285062
GRCz11 12 3396702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGCTGTATGTTGCTGTGTTCTGCTATATTTTGCGGTACCAATGCTG[T/A]ATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 412 437 1 1
Genomic Location (Zv9):
Chromosome 12 (position 3990684)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3285110
GRCz11 12 3396750
KASP Assay ID:
554-7861.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTG[C/A]TGTATTCTGCTGTATTTTGCGGTACCACTGCTGTATGTTGCTGTATTCTG
Associated Phenotype:
Not determined