Busch Lab

ZMP

si:ch1073-376g14.1

Ensembl ID:
ENSDARG00000086290
ZFIN ID:
ZDB-GENE-100922-265
Human Orthologue:
ZNF804B
Human Description:
zinc finger protein 804B [Source:HGNC Symbol;Acc:21958]
Mouse Orthologue:
AC112662.1
Mouse Description:
zinc finger protein 804B [Source:RefSeq peptide;Acc:NP_001156695]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa30689 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11375 Nonsense Available for shipment Available now
sa28674 Nonsense Mutation detected in F1 DNA Not yet available
sa42736 Nonsense Mutation detected in F1 DNA Not yet available
sa10089 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30689
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Essential Splice Site 39 1271 2 4
ENSDART00000133696 None 1 89 1 2
Genomic Location (Zv9):
Chromosome 16 (position 30186045)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28023183
GRCz11 16 27957806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATGCATAACCAACAGTCTCTTTCTCTCTCTTTCTCTCTCTCTGTTTT[A/C]GGACTACGCTAAGAAAGAGAAAGCCATTGCAAAAGCCCTGGGGGATTTGA
Long Flanking Sequence:
CAAGAACAAGACTGTGTTTCTTTCTCATGTGTTAAAATGACTTGTACGTAAGTAGTTAAGTACAGTTATATTATGGCTAATTATTACCATGATCACAATGAAGGTTGTCATTTCTCACAGACTAATATCACAACCCTGTTGTCATAGCAACAAAGCAATGCTAAAATTCAAGCATCTTCTTAAAAATGCTGTTGTTGCTATGCTAGTAATTATGGCAAAATATATTTTAAAAAACACATGATAAAAAAAAAAAAAAAATCTGTAATGGTTTGGTTTCATCACGTTCTTCTTGATAGAATGAGACAATCTGTAAAAAATAAAAATACCTGATTGATATTTATGTGATGTTTATAGCCGTTTCCCTTCTTTTGTGGTTTTAAATAATCAGGGAAATCAATTTGTATTCTTAAAAAAAGGACTGTGTGATTGTCAAGTGTCGTTATAAGCAACTACATGCATAACCAACAGTCTCTTTCTCTCTCTTTCTCTCTCTCTGTTTT[A/C]GGACTACGCTAAGAAAGAGAAAGCCATTGCAAAAGCCCTGGGGGATTTGAAGGCTAACTTCTATTGTGAACTGTGTGACAAGCAGTACCATAAATATCAGGAGTTTGACAACCACATCAACTCCTATGACCACGCACATAAACAGGTAAACTTATAACATGGGTAGGCAGGAAAGCAAAGAAATGAAAGAATAGTTGAAGCATTAATTTACAAGTCAATACTAATAAGCAGTTTGTCTGTATACATAATGTTATGCATAGAAATTATTGTGTGCTTGATCGGGCAAACACACTGCTTGACCATTGTTTGCTTTTTGTTTTCCCAAATGGTCTTACATCATGCGGACAGCTGTTGACAAACCGAATATTTGCACACTTTGCTTATTATCCTGAAATTCTAACAGCATTCAGGGACACTGAATAAAGCACATGAGGTGTACCTGAGGTGATCATTGTCAGTTTTCTGTTGTTCAGCTGCAAGAAATAGAAGCTGTTTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11375
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 110 1271 3 4
ENSDART00000133696 Nonsense 72 89 2 2
Genomic Location (Zv9):
Chromosome 16 (position 30227041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28064179
GRCz11 16 27998802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGAGAATTTGCACGGAATGTTTCCTCCAAGTCTTGGAAAGATGAAAAA[A/T]AGCARAAACGWGCTCTGAAACGACTGCATCAGCTTGCACAACTCAAACAG
Long Flanking Sequence:
GTCTACAGAACAAATTCTGGCACAGCTGACACTTTTATTGTTTTGTGATTGTATTTAGGCTTTGCTGATTTTCTGTTTACTTTGTTTCGATTTTTTTTCTCCTCTGCCCTAAAGGGATATTGTGATAAATAGACAGGCATCCATCGGTGAGGTTTATGCCTTTTCAAAGGAGCCTTTTATGTGGAAAACTGATGGACTGCACAGGCTCTGTTAGCAGAAGAATTAGAAAGAGGTGTTTTTTTTTTCTTAAAGGGATTATTTTTTTTAATTGTTTTCTCTCAATTGTACGCTAGGTTAGACCTTGATTCTTTTGTTTCTTTTTTTTCTCCTGATGTAAAATTCATTAGGTTCTTTATATAGCCAAACAATTGTTCTTTTTATGGGAGACTTTAGATTTTTAGAACTTCTCATCTGTTAATTTTGTCTTACAGAGGCTGAAAGAGTTAAAGCAGAGAGAATTTGCACGGAATGTTTCCTCCAAGTCTTGGAAAGATGAAAAA[A/T]AGCAGAAACGAGCTCTGAAACGACTGCATCAGCTTGCACAACTCAAACAGCAAAGAGACAGGTAAATCATTGTGCACTTTTAATTCTGTGTGTGGTAAGTAGCCGCGTTTCCACTATCGCGCCTAAAGCGAGCGAGCCAGGGCGAGCCAAGGCCAGTGGGGTTTCCACTGTCACTTCCGGGGCCTGATCGGGCCAAAGCGGGGCTTTCTTGGGGCCAGCGGCCGGCCTTTTTCGGCCCGCCGAATACCTTGGGAGGGCCAGCTGGGGCTTCGGGGCGGAGTGAAAGGAGAGGCGGGCAGTTTTCTGATCGCACATGAGTACATGCGCCAAACAAATAAAGAAATAAGGGAAATAAAACATCTAGCCTTATAGTCTGGGGTCTTTTTGCGTATGATCACCCTTATGTTTCCCTTTTAAATGTAAGGCTGCTGCATAAAATAATAAAATAGTTTTAATTTATAGTGACGTTCTTTGCTGCGTCCTCCTTTATGTTTCAATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28673
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 443 1271 4 4
ENSDART00000133696 None None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30229953)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28067091
GRCz11 16 28001714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGTTCCTTTCTTAATGTACTCAGCAAGGATGGAAATGTGACGAAATG[G/A]CCATTTGAGCTGGTTCAGTTCACTTCTGAGGAGCCACGTGTATCTTTCAG
Long Flanking Sequence:
TCCCATGATCCTCCTACCTTGGACTGGGTGGATGGAGACTCTCAAACACTGCAAATGGAAGCACAAGAGAAACATGTGGAGAGTAATGACTTTGAGGCAAACTACAGCACAAGTGAGCCAGAAAAGCTGGGGTGTCCTGACACACAGAGTCCTGGAGCAGACTGGAAGCCAGCTGGTTCAGAAGACAGATTGCTTGATGGGGGGCAGAGACCCAGGGCAGAGGGGGCTTATGGGGGATCAGAGGAGAGAGAATGCCTCAAGTGCCCCAGCCTTACTGTTTACACAGATGGACAGGGCACTATGGCCCATAGCCAACTCCAAATACAGAAAGACTCACACCACTATACACAGAGAAGCAGTGAAGAGCCTATTATGCAGAATGGGAGAGACTGTGAGCCAGAAAAAGAGACAGTGGAATATAAAATACAAAGAGTTTGCAAAGATGACAATACAGGTTCCTTTCTTAATGTACTCAGCAAGGATGGAAATGTGACGAAATG[G/A]CCATTTGAGCTGGTTCAGTTCACTTCTGAGGAGCCACGTGTATCTTTCAGCTGTAACCCTCTCTGCTGCTATTTAAAACACAAGAAGGGCAAACACAAAAGCACAAAGGCTGAGGAGGTAAATCTTGATGCTGTTGACAAGCTCGCAGTCCAGAATGACAGAGCTGGGCCACAAACACAGAATGTTCCAGGAGATAAATTAGGCATTTTAAAACCAAAGAAACCCAAACACAGGAGAAAGGAGAAAAGACGTAGGCGTAAATTAGATGCTGTCAGGATCCGGCAAGCAGGCTGCGCATTTAAAACCTGCTCACAGACAGAAGCTGGAGGACACTTTGAATTCCAAAGCACTCCAACCGACACGTCACAAAACAAGCAAGTGTGCACAGAGAGGAGGCACAAGCTGGGAAAAAGGAAAAGATCAGTGAGAGATGAGACTTCAAATGAAAGTGACACCCCAGAGCACAGCCTCAAAAGCATTGTTGTAAGCTCGCTTTCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28674
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 868 1271 4 4
ENSDART00000133696 None None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30231228)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28068366
GRCz11 16 28002989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCCCAGTTCCTCTAGTAGCACTAGCATCTCTGATCTTAGTGGGGATTG[G/A]TCATCTAATTGCCAAATTAAACCATCACCTACGAGACAGAGCCAGAAACA
Long Flanking Sequence:
AACTATCTATACCCTTTGAGAAAGGAGCACAGTCAGCCCAGGTCTTACTTTAGAGGTTCCTCAAACAATGTTCCTCACTACAGTTGTAGTCCATGTAGAGATTTTGAAGATACAGGAGAAAGTTGGGATTACGCAGACTCGTACATCTACAATAAGCAAAGAAATTCAACTATTTGTAATGGCCCAGATCAGCATGAGAGGTACGGCATAAGAAGGCACAAACCATTTTTTGAGAACCATAAACATAGAGAGCACAGAATTCAACATGCAGGCAGACAGTTTTTTTACAGAGTCTTTGACAGCCCCGAACCTCAGGAAGATGACAGGGACTGGTGGTACAATGACAGACTTAGTCCTGTAGGTAGGAGGCATCAGGAAAGAGAAGAATTTCAGTGGTCAAGTCCAGAAAGAAGTGAAGACAGGTGGTATAACAAGCCAGTGCCCATTCGTAGCCCCAGTTCCTCTAGTAGCACTAGCATCTCTGATCTTAGTGGGGATTG[G/A]TCATCTAATTGCCAAATTAAACCATCACCTACGAGACAGAGCCAGAAACATTCTGAATTGCCTTCTGAGAGATTGGTCAAGACCAAATCCTCCCTTTCTCCTCTTAGAAAGAGAAGCCATTTACCACCATTAGCCACAAGTAACCATTGCACACAGTCTAATTCCTTAAACATAGGTGTAGTGAAGGAAGATGTTACACACAAGATTAACACAATCGCAGCAGATCCATTGGTTGAGAAGGATTCTAAATTAAAGAAAGGACATTTTCTCTCACTTCCACTAATTGGCAAATTACCATCTATTAAGAATGGGGCAAGAAAAAGAGGGATTAATAAAGATGCAGGTGCCAGTATTAGTAGCCTGGTTCAAACAACCTCAACTCCCCTATCAAATCCACAAGTTATGCCTCACATCGGCATCAAGAATCCAGAATGCTTGCAAGACAGAAATGGCCAAAATCCCAGTGAGGCCCATACTTGTCTTGAAACTACCAATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 945 1271 4 4
ENSDART00000133696 None None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30231458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28068596
GRCz11 16 28003219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGAAGGAAGATGTTACACACAAGATTAACACAATCGCAGCAGATCCAT[T/A]GGTTGAGAAGGATTCTAAATTAAAGAAAGGACATTTTCTCTCACTTCCAC
Long Flanking Sequence:
TGAGAACCATAAACATAGAGAGCACAGAATTCAACATGCAGGCAGACAGTTTTTTTACAGAGTCTTTGACAGCCCCGAACCTCAGGAAGATGACAGGGACTGGTGGTACAATGACAGACTTAGTCCTGTAGGTAGGAGGCATCAGGAAAGAGAAGAATTTCAGTGGTCAAGTCCAGAAAGAAGTGAAGACAGGTGGTATAACAAGCCAGTGCCCATTCGTAGCCCCAGTTCCTCTAGTAGCACTAGCATCTCTGATCTTAGTGGGGATTGGTCATCTAATTGCCAAATTAAACCATCACCTACGAGACAGAGCCAGAAACATTCTGAATTGCCTTCTGAGAGATTGGTCAAGACCAAATCCTCCCTTTCTCCTCTTAGAAAGAGAAGCCATTTACCACCATTAGCCACAAGTAACCATTGCACACAGTCTAATTCCTTAAACATAGGTGTAGTGAAGGAAGATGTTACACACAAGATTAACACAATCGCAGCAGATCCAT[T/A]GGTTGAGAAGGATTCTAAATTAAAGAAAGGACATTTTCTCTCACTTCCACTAATTGGCAAATTACCATCTATTAAGAATGGGGCAAGAAAAAGAGGGATTAATAAAGATGCAGGTGCCAGTATTAGTAGCCTGGTTCAAACAACCTCAACTCCCCTATCAAATCCACAAGTTATGCCTCACATCGGCATCAAGAATCCAGAATGCTTGCAAGACAGAAATGGCCAAAATCCCAGTGAGGCCCATACTTGTCTTGAAACTACCAATGAAAATAGATCGAAAGAATTCTGTGCTACTTTAGCTTCGGATTCAAACAATATTCAGAAGCATACTGTCAGAGGCCAAGCAGACCATCCAGAAATTGCAGGGATTCACTGTTCAAAACGTACCACTCCTCCCCTTTCTGAACAGCCAATCACCTTCACTGATGATGAAATTGAGAAGTACAGATTGCTTCAACTCCAGGCCCAGCAGCACATGCAGCAGCAGCACCTTCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10089
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 1160 1271 4 4
ENSDART00000133696 None None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30232103)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28069241
GRCz11 16 28003864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCTCTCCAACCTCCTCTATCATTCCTCACCSWTCCCCTGTTACCCTCT[T/G]ACCTACCATTCATCACTCYCTTTCTCTGCCCCATTTTGCCCCTTCGATCC
Long Flanking Sequence:
CTCAACTCCCCTATCAAATCCACAAGTTATGCCTCACATCGGCATCAAGAATCCAGAATGCTTGCAAGACAGAAATGGCCAAAATCCCAGTGAGGCCCATACTTGTCTTGAAACTACCAATGAAAATAGATCGAAAGAATTCTGTGCTACTTTAGCTTCGGATTCAAACAATATTCAGAAGCATACTGTCAGAGGCCAAGCAGACCATCCAGAAATTGCAGGGATTCACTGTTCAAAACGTACCACTCCTCCCCTTTCTGAACAGCCAATCACCTTCACTGATGATGAAATTGAGAAGTACAGATTGCTTCAACTCCAGGCCCAGCAGCACATGCAGCAGCAGCACCTTCAAGAGCAAGCATCTGAGGAGATGACTTTACCAATCCCAGCTCCAAAGCCACTCAACCAGACTGCACTTTCAGCCTGTATGCCATACAGCATACTTCAGCCATCCTCTCCAACCTCCTCTATCATTCCTCACCCATCCCCTGTTACCCTCT[T/G]ACCTACCATTCATCACTCTCTTTCTCTGCCCCATTTTGCCCCTTCGATCCCTGCTGCCTTTTTTCCTGCGCCCCCTGCAACTGTGTTGGCAGCTCAGCCACTCCAACTGATCCCAGCCTCATCCCTCCATCCAGTTCACCCTCACCATCATGTTTCTGGGTTGACTCTCCACCCCCTGCCTCCCACTTCTCTGCTCCCTGCAATGCTTAGTCCAATGCCCATGGCTGCTGCCGCTGCTGCAGCCGTCGCTGCTGCCAGTACCCTGCAGATCCACCCCCTACTACACCCTCTGTTCCACAGCCAGGACCTTCAGCGGCACCCTGGACCAACCAGTTAGTTCTGGTCAGAATTATAAGGAAATTTTGAATAAACAAAAAGATTATAGTTCTGACATTTTTTTTTTTTTTTACAAAATTACTGCAAATGTGCTGTGAACTTTTGAGATGTTTAGGTTCTCTCTGCCAAAGGTCCTGTTCAGCCGTGATTTATTTTTGTTTTAT
Associated Phenotype:
Not determined