Busch Lab

ZMP

scg3

Ensembl ID:
ENSDARG00000086288
ZFIN ID:
ZDB-GENE-040426-1725
Description:
secretogranin III [Source:RefSeq peptide;Acc:NP_957051]
Human Orthologue:
SCG3
Human Description:
secretogranin III [Source:HGNC Symbol;Acc:13707]
Mouse Orthologue:
Scg3
Mouse Description:
secretogranin III Gene [Source:MGI Symbol;Acc:MGI:103032]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43156 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43156
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122930 Nonsense 44 478 2 12
Genomic Location (Zv9):
Chromosome 18 (position 37908265)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39489968
GRCz11 18 39470976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATCTAGACAAGTACAACCGTGAGCTGACTGAAGAGAAGCCTTTAGAA[C/T]AGCAGGTGTGATTTTGCTAATCTTAACTTTGTCATAAAACACAGAAATCT
Associated Phenotype:
Not determined