Busch Lab

ZMP

zgc:112992

Ensembl ID:
ENSDARG00000086281
ZFIN ID:
ZDB-GENE-050417-469
Description:
apolipoprotein A-IV [Source:RefSeq peptide;Acc:NP_001017909]
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29171
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124825 Nonsense 95 234 4 4
Genomic Location (Zv9):
Chromosome 19 (position 11963817)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10931370
GRCz11 19 10850295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCCAGGAGGCCGATCAGCTGAAACTGAGTCTGGAGCAAGAAATCACCT[C/A]GGCACAGACCCAGCTCAAGCCTTATGTTGAAGAACTCAAAGTGGACATTG
Long Flanking Sequence:
GATCCGCTGTGATTATTTACTTTACTTTAAAAAAGTGAGTTAACCACTTGCCTTAGAAGCAACTAATTGAATTTACTTAAACAAAGGAGTAAACCCATTTTAACTTAGAACTGTCAAGTTCATTTAACTTTAGAAATCATGCACATGGTTCACTTAAAATTTGTAAGGCGATGGGTTTACTTTATCTTGGACTTTACCTAAAGTAAAGTCAACTAATTATTTTAAAAGCAGCAGGTTTTCTCACTATTTTAAGTAAAGTCAACTAATCATTTTCACAGGGTAGCAAATAGCAAAGCACATCCCAAACCGGCTATAAAAACAATAATTAAATAATCTATCTCTGTTTCTTCTCAGTGACAGGATCTCTAAAAGCACAGATGCCATCAATAAATACACCCTGGCCATTCAAAGTCAGGTCACTCCTTTGACCCAAGAACTGCTCACCAAACTGTCCCAGGAGGCCGATCAGCTGAAACTGAGTCTGGAGCAAGAAATCACCT[C/A]GGCACAGACCCAGCTCAAGCCTTATGTTGAAGAACTCAAAGTGGACATTGAGGAGCAGATTGAGCGGCTGAAAAAGGACGTGGCTCCATACGCAGAGGCCCTGAACCCTGAAGCCATGAGGTTGACCCTGGTCCTGCGGGCTGAAGAGCTGAAGGCAAAGCTGGAAACAAGTTTGATGGCGATGGGTCCTCAGAGCGAGGAGCTGAAGCAGAAGCTGGAGCAGCACTTTGTGGAGTTTCAGATGAGCATGTCTCCACTGGCTGAGAGTTTTCAGAGTCAGCTGGCCCAGAGAAGTCAGGAGCTCCAGAAGAATCTGGCTCCCTATTCTGAAGAGCTGAGCAAACTAGATCCGCTCGCTCAGGATCTGAAGGACCAGCTGACTGCCCTCTGGGAGTCCTTCGCCAAGGATAAACAGTCGTGAAAGACTCTAGAGACTTTTAGATATGCGTAATTTATGTTATTTTTGGATTTAATATATATTTTTGTCATTCATGCATGTT
Associated Phenotype:
Not determined